BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation2214014 1 Help:Barcodes range2214014 1 682 706 annotation1014044 1 mrfp1 range1014044 1 1 675 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1913025 1 BBa_K1913025 Wild type plac-FixK2 hybrid promoter 2016-10-12T11:00:00Z 2016-10-14T03:31:57Z Genomic sequence of Bradyrhizobium japonicum Wild type plac-FixK2 hybrid promoter is the promoter that could not only be activated by light sensorsYF1-FixJ composite and but inhibited by LacI repressor. The sequence of upper control element and core element region are from wild type FixK2 hybrid promoter on genomic sequence of Bradyrhizobium japonicum. Addition lac operators on the both side of promoter as second control element that results in transcription repression. false false _2380_ 29979 29979 9 false In order to make Fixk2 promoter as an inducible promoter for the toggle switch,we had to add additional repressor operator sequences into the Fixk2 sequence, they are both on upstream and downstream the Fixk2 sequence, which could be bonded by tetrameric Lac repressor resulting in the formation of a DNA loop and consequently on transcription repression. false Tianhe Wang annotation2497352 1 FixJ box range2497352 1 90 97 annotation2501595 1 RBS range2501595 1 153 157 annotation2497357 1 -35 range2497357 1 98 98 annotation2497350 1 Lac operator range2497350 1 1 21 annotation2497354 1 -10 range2497354 1 120 120 annotation2497351 1 FixJ box range2497351 1 64 67 annotation2497353 1 Lac operator range2497353 1 132 152 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1913027 1 BBa_K1913027 Wild type plac-FixK2 hybrid promoter with mRFP 2016-10-13T11:00:00Z 2016-10-14T06:48:07Z Genomic sequence of Bradyrhizobium japonicum, iGEM part registry. plac-FixK2 hybrid promoter composite part includes mRFP reporter (BBa_E1010). After co-transformation with light sensor BBa_K1913033, mRFP fluorescence could be detected after 12h culture. false false _2380_ 29979 29979 9 false In order to test wild type plac-FixK2 hybrid promoter,we put reporter mRFP under this promoter and co-transformed with light sensor BBa_K1913034. And mRFP fluorescence value was tested so that the intensity of transcription of this promoter could be quantified. false Tianhe Wang component2503045 1 BBa_K1913025 component2503055 1 BBa_B0015 component2503048 1 BBa_E1010 annotation2503048 1 BBa_E1010 range2503048 1 164 869 annotation2503045 1 BBa_K1913025 range2503045 1 1 157 annotation2503055 1 BBa_B0015 range2503055 1 878 1006 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1913025_sequence 1 ggcagtgagcgcaacgcaattccatccaggaccggcctcgggcatgacctacggggttctacgtaaggcaccccccttaagatatcgctcgaaattttcgaacctcccgataccgcgtaccaatgcgtcataattgtgagcggataacaattggaga BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1913027_sequence 1 ggcagtgagcgcaacgcaattccatccaggaccggcctcgggcatgacctacggggttctacgtaaggcaccccccttaagatatcgctcgaaattttcgaacctcccgataccgcgtaccaatgcgtcataattgtgagcggataacaattggagatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z