BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1913029 1 BBa_K1913029 Synthetic plac-FixK2 hybrid promoter +RBS with mRFP 2016-10-13T11:00:00Z 2016-10-19T04:02:56Z Genomic sequence of Bradyrhizobium japonicum, iGEM part registry. Synthetic plac-FixK2 hybrid promoter composite part includes mRFP reporter (BBa_E1010). After co-transformation with light sensor BBa_K1913033, mRFP fluorescence could be detected after 12h culture. false false _2380_ 29556 29979 9 false In order to test synthetic plac-FixK2 hybrid promoter,we put reporter mRFP under this promoter and co-transformed with light sensor BBa_K1913034. And mRFP fluorescence value was tested so that the intensity of transcription of this promoter could be quantified. false Tianhe Wang component2503214 1 BBa_K1913022 component2503217 1 BBa_E1010 component2503224 1 BBa_B0015 annotation2503224 1 BBa_B0015 range2503224 1 877 1005 annotation2503214 1 BBa_K1913022 range2503214 1 1 156 annotation2503217 1 BBa_E1010 range2503217 1 163 868 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1913022 1 BBa_K1913022 Synthetic plac-FixK2 hybrid promoter with RBS 2016-10-13T11:00:00Z 2016-10-19T03:38:55Z Genomic sequence of Bradyrhizobium japonicum. Synthetic plac-FixK2 hybrid promoter is the promoter that could not only be activated by light sensorsYF1-FixJ composite and but inhibited by LacI repressor. The sequence of upper control element is from wild type FixK2 hybrid promoter on genomic sequence of Bradyrhizobium japonicum, which contains two typical FixJ boxes. And core element region is replaced by constitutive promoter BBa_J23106. Addition lac operators on the both side of promoter as second control element that results in transcription repression. false false _2380_ 29556 29979 9 false according to some previous iGEM projects (UNITN-Trento 2013, INSA-Toulouse 2013), the transcription activity of the wild type Fixk2 promoter is so weak that they all added an inverter part to control their target gene expression. Even the original pDusk system in darkness has only 5 times expression levels than in light conditions. Therefore, we decided to enhance the transcriptional activity of the Fixk2 promoter by changing the core element region of the wild type Fixk2 by a strong constitutive promoter (BBa_J23106) from iGEM part registry and by adding two typical FixJ boxes into the -40 to -70 region. false Tianhe Wang annotation2502073 1 FixJ box range2502073 1 75 88 annotation2502074 1 BBa_J23106 range2502074 1 89 123 annotation2502068 1 FixJ box range2502068 1 41 48 annotation2501918 1 conserved range2501918 1 5 8 annotation2502078 1 lac operator range2502078 1 1 21 annotation2502076 1 lac operator range2502076 1 124 144 annotation2501919 1 BBa_B0034 range2501919 1 145 156 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K1913022_sequence 1 ggcagtgagcgcaacgcaattccatccaggaccggcctcggtacgtagccggcctcgggcatgacctacggggtttgatctgggtcaatttacggctagctcagtcctaggtatagtgctagcaattgtgagcggataacaattaaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1913029_sequence 1 ggcagtgagcgcaacgcaattccatccaggaccggcctcggtacgtagccggcctcgggcatgacctacggggtttgatctgggtcaatttacggctagctcagtcctaggtatagtgctagcaattgtgagcggataacaattaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z