BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_K1913024 1 BBa_K1913024 Synthetic ptet-FixK2 hybrid promoter with RBS 2016-10-13T11:00:00Z 2016-10-19T03:46:38Z genomic sequence of Bradyrhizobium japonicum Synthetic ptet-FixK2 hybrid promoter is the promoter that could not only be activated by light sensors YF1-FixJ composite and but inhibited by TetR repressor. The sequence of upper control element is from wild type FixK2 hybrid promoter on genomic sequence of Bradyrhizobium japonicum, which contains two typical FixJ boxes. And core element region is replaced by core element region of BBa_J23106. Addition tet operators are inserted into core element region of promoter as second control element that results in transcription repression. false false _2380_ 29556 29979 9 false According to some previous iGEM projects (UNITN-Trento 2013, INSA-Toulouse 2013), the transcription activity of the wild type Fixk2 promoter is so weak that they all added an inverter part to control their target gene expression. Even the original pDusk system in darkness has only 5 times expression levels than in light conditions. Therefore, we decided to enhance the transcriptional activity of the Fixk2 promoter by changing the core element region of the wild type Fixk2 by adding a strong constitutive promoter (BBa_J23106) from iGEM part registry and by adding two typical FixJ boxes into the -40 to -70 region. false Tianhe Wang annotation2502783 1 -10 range2502783 1 93 98 annotation2502777 1 tet operator range2502777 1 74 92 annotation2502785 1 -35 range2502785 1 68 73 annotation2502762 1 FixJ box range2502762 1 54 67 annotation2502761 1 FixJ box range2502761 1 20 27 annotation2502759 1 BBa_B0034 range2502759 1 124 135 annotation2502758 1 conserved range2502758 1 5 8 annotation2502781 1 tet operator range2502781 1 99 117 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1913031 1 BBa_K1913031 Synthetic ptet-FixK2 hybrid promoter+RBS with mRFP 2016-10-13T11:00:00Z 2016-10-19T04:06:49Z Genomic sequence of Bradyrhizobium japonicum, iGEM part registry. Synthetic ptet-FixK2 hybrid promoter composite part includes mRFP reporter (BBa_E1010). After co-transformation with light sensor BBa_K1913033, mRFP fluorescence could be detected after 12h culture. false false _2380_ 29556 29979 9 false In order to test synthetic ptet-FixK2 hybrid promoter,we put reporter mRFP under this promoter and co-transformed with light sensor BBa_K1913034. And mRFP fluorescence value was tested so that the intensity of transcription of this promoter could be quantified. false Tianhe Wang component2503265 1 BBa_K1913024 component2503268 1 BBa_E1010 component2503275 1 BBa_B0015 annotation2503275 1 BBa_B0015 range2503275 1 856 984 annotation2503265 1 BBa_K1913024 range2503265 1 1 135 annotation2503268 1 BBa_E1010 range2503268 1 142 847 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1913031_sequence 1 ccatccaggaccggcctcggtacgtagccggcctcgggcatgacctacggggtttgatctgggtcaatttacgtccctatcagtgatagagatatagttccctatcagtgatagagagctagcaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1913024_sequence 1 ccatccaggaccggcctcggtacgtagccggcctcgggcatgacctacggggtttgatctgggtcaatttacgtccctatcagtgatagagatatagttccctatcagtgatagagagctagcaaagaggagaaa BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z