BBa_K1914003 1 BBa_K1914003 pT7- E. coli optimised - KillerRed (EOKR) 2016-10-06T11:00:00Z 2016-10-12T09:46:14Z Carnegie Melon iGEM 2013 part BBa_K1184000 http://parts.igem.org/Part:BBa_K1184000 Maria E Bulina, M. E., Dmitriy M Chudakov, D. M., Britanova, O. V., Yanushevich, Y. G., Staroverov, D. B., Chepurnykh, T. V., Merzlyak, E. M., Shkrob, M.A., Lukyanov, S. and Lukyanov, K. A., 2006. A genetically encoded photosensitizer. Nature Biotechnology, 24(1), pp. 95-99. KillerRed is a photoactiated kill switch with an IPTG inducible T7 promoter. false false _2381_ 31076 31076 9 false Codon optimised for E.coli using IDT software. false Eloise Lloyd component2494001 1 BBa_B0034 component2494009 1 BBa_B0015 component2493999 1 BBa_I712074 component2494002 1 BBa_K1914002 annotation2494001 1 BBa_B0034 range2494001 1 55 66 annotation2493999 1 BBa_I712074 range2493999 1 1 46 annotation2494009 1 BBa_B0015 range2494009 1 801 929 annotation2494002 1 BBa_K1914002 range2494002 1 73 792 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1914002 1 BBa_K1914002 E. coli Codon Optimised KillerRed(EOKR) 2016-10-06T11:00:00Z 2016-10-07T04:11:58Z Carnegie Melon iGEM 2013 KillerRed is a photoactivated RFP, this is a E.coli codon optimised version, of the original part BBa K1184000 from the iGEM registry, using IDT software. false false _2381_ 31076 31076 9 false Codon optimised for E.coli using IDT software false Eloise Lloyd BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1914003_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcatactagagaaagaggagaaatactagatgggcagtgaaggtggtcctgcgcttttccagtcagacatgaccttcaaaattttcattgacggtgaagttaatggacagaaatttacgatcgtagccgatggctcaagcaaattcccacatggggacttcaatgtccacgccgtgtgcgaaacaggcaaattacccatgagctggaagccgatttgtcatttgattcagtacggggagccttttttcgctcgttacccagatggaatttctcactttgcccaggagtgttttcccgaaggactgtctatcgatcgtaccgtgcgctttgaaaacgacggtactatgacctcgcatcatacctatgaattagacgatacatgcgtggtaagtcgtatcacggtaaactgcgacggttttcaacctgatggcccaatcatgcgtgaccagttggtcgatatcctgcctaatgaaacccatatgttcccgcatgggccaaatgcggtccgccaattagcattcatcgggttcacgactgcggacggcggacttatgatggggcattttgactctaagatgacctttaacggttcgcgcgcgattgaaattcctgggccgcactttgtgacgattattacaaagcaaatgcgtgatacatctgacaaacgcgaccacgtctgtcaacgtgaagtcgcttacgcacattcagtgcctcgcattaccagtgcgatcggttcagatgaggactgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca BBa_K1914002_sequence 1 atgggcagtgaaggtggtcctgcgcttttccagtcagacatgaccttcaaaattttcattgacggtgaagttaatggacagaaatttacgatcgtagccgatggctcaagcaaattcccacatggggacttcaatgtccacgccgtgtgcgaaacaggcaaattacccatgagctggaagccgatttgtcatttgattcagtacggggagccttttttcgctcgttacccagatggaatttctcactttgcccaggagtgttttcccgaaggactgtctatcgatcgtaccgtgcgctttgaaaacgacggtactatgacctcgcatcatacctatgaattagacgatacatgcgtggtaagtcgtatcacggtaaactgcgacggttttcaacctgatggcccaatcatgcgtgaccagttggtcgatatcctgcctaatgaaacccatatgttcccgcatgggccaaatgcggtccgccaattagcattcatcgggttcacgactgcggacggcggacttatgatggggcattttgactctaagatgacctttaacggttcgcgcgcgattgaaattcctgggccgcactttgtgacgattattacaaagcaaatgcgtgatacatctgacaaacgcgaccacgtctgtcaacgtgaagtcgcttacgcacattcagtgcctcgcattaccagtgcgatcggttcagatgaggactga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z