BBa_K1914004 1 BBa_K1914004 Lysozyme C E.coli codon optimised, signal peptide, flag tag 2016-10-06T11:00:00Z 2016-10-07T05:08:53Z Lysozyme from Gallus gallus Part:BBa_K284001 http://parts.igem.org/Part:BBa_K284001 Lysozyme C from Gallus gallus, codon optimised for E.coli using IDT website programme. A flag tag was added as well as an OmpA signal peptide amino acid sequence came from E. coli and targets the lysozyme to the periplasm. The device is under a T7 IPTG inducible promoter. false false _2381_ 31076 31076 9 false E.coli optimisation using IDT website programme, OmpA signal peptide targeting to the periplasm, flag tag false Eloise Lloyd BBa_K1914004_sequence 1 atgaagaagaccgcgattgccatcgctgttgctcttgctggcttcgctacggtcgcgcaggctgactataaagacgatgatgataaaaaagtcttcggtcgctgtgagcttgccgcagccatgaagcgccacgggcttgacaactaccgtggatactcattaggaaactgggtctgcgctgctaaattcgaatctaacttcaatacgcaagcgaccaatcgtaacacagatggatcgacagactatggtattttgcaaattaacagtcgctggtggtgtaatgatggccgcacacccggatcacgtaatctgtgtaatatcccatgctctgcgcttttatctagcgacatcaccgcttccgtgaactgcgctaagaagattgtgtcagacggaaacggaatgaacgcttgggttgcttggcgtaatcgttgtaaaggcactgatgtccaagcctggattcgcggatgccgcctgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z