BBa_K1915002 1 BBa_K1915002 LTNF15 2016-10-13T11:00:00Z 2016-10-14T11:08:34Z The sequence for the LTNF peptides were obtained from (G Chavan, et. al. (2014). Protein and peptide letters) The full sequence was synthesized by IDT. LTNF15 (Lethal Toxin Neutralizing Factor) is a 10 residue peptide that has been shown to neutralize toxins from snakes, scorpions, and bacteria. LTNF peptides were first isolated from opossum (Didephis virginiana) serum. This part contains the LTNF15 peptide as well as C-term Myc and 6xHis tags that can be used for purification and then later removed using the HRV (Human Rhinovirus) protease. false false _2382_ 33829 33829 9 false N/A false Tatenda Tela annotation2507148 1 HRV 3C site range2507148 1 46 69 annotation2507124 1 LTNF15 range2507124 1 1 45 annotation2507187 1 stop codon range2507187 1 133 135 annotation2507151 1 6 His range2507151 1 115 132 annotation2507150 1 Myc tag range2507150 1 70 99 BBa_K1915002_sequence 1 ctgaaagcgatggatccgaccccgccgctgtggattaaaaccgaactggaagtgctgtttcagggcccggaacagaaactgattagcgaagaagatctgaccagcgcggtggatcatcaccatcatcaccattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z