BBa_J61101 1 BBa_J61101 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A fix false false _95_ 0 483 95 In stock false N/A true John Anderson BBa_K1915003 1 BBa_K1915003 Inducible Lac promoter+LTNF15 2016-10-13T11:00:00Z 2016-10-18T07:00:49Z This is a composite part that was assembled through gene synthesis from IDT. This is a generator part for BBa_K1915002. This part includes an IPTG inducible promoter, RBS J61101, and the LTNF15 peptide coding sequence. false false _2382_ 16948 33829 9 false This composite part was synthesized as a whole unit by IDT. Therefore there are no Biobrick scars. Instead a spacer "TCATAGAG" was included following R0011 and "TACTAGATG" following J61101 to improve translation. false Tatenda Tela component2519942 1 BBa_R0011 component2519947 1 BBa_K1915999 component2519948 1 BBa_J61101 component2519949 1 BBa_K1915998 component2519955 1 BBa_K1915002 annotation2519948 1 BBa_J61101 range2519948 1 64 75 annotation2519949 1 BBa_K1915998 range2519949 1 76 84 annotation2519955 1 BBa_K1915002 range2519955 1 85 219 annotation2519947 1 BBa_K1915999 range2519947 1 56 63 annotation2519942 1 BBa_R0011 range2519942 1 1 54 BBa_K1915998 1 BBa_K1915998 LTNF Scar 2 2016-10-17T11:00:00Z 2016-10-18T06:22:12Z NA LTNF Scar from IDT false false _2382_ 16948 16948 9 false NA false Jessica Siemer BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2002 1 -10 range2002 1 43 48 annotation1999 1 lac O1 range1999 1 3 19 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 annotation2000 1 -35 range2000 1 20 25 BBa_K1915999 1 BBa_K1915999 LTNF Scar1 2016-10-17T11:00:00Z 2016-10-18T07:10:11Z NA Scar from IDT part false false _2382_ 16948 16948 9 false NA false Jessica Siemer BBa_K1915002 1 BBa_K1915002 LTNF15 2016-10-13T11:00:00Z 2016-10-14T11:08:34Z The sequence for the LTNF peptides were obtained from (G Chavan, et. al. (2014). Protein and peptide letters) The full sequence was synthesized by IDT. LTNF15 (Lethal Toxin Neutralizing Factor) is a 10 residue peptide that has been shown to neutralize toxins from snakes, scorpions, and bacteria. LTNF peptides were first isolated from opossum (Didephis virginiana) serum. This part contains the LTNF15 peptide as well as C-term Myc and 6xHis tags that can be used for purification and then later removed using the HRV (Human Rhinovirus) protease. false false _2382_ 33829 33829 9 false N/A false Tatenda Tela annotation2507151 1 6 His range2507151 1 115 132 annotation2507148 1 HRV 3C site range2507148 1 46 69 annotation2507124 1 LTNF15 range2507124 1 1 45 annotation2507150 1 Myc tag range2507150 1 70 99 annotation2507187 1 stop codon range2507187 1 133 135 BBa_K1915002_sequence 1 ctgaaagcgatggatccgaccccgccgctgtggattaaaaccgaactggaagtgctgtttcagggcccggaacagaaactgattagcgaagaagatctgaccagcgcggtggatcatcaccatcatcaccattaa BBa_J61101_sequence 1 aaagacaggacc BBa_K1915003_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatcatagagaaagacaggacctactagatgctgaaagcgatggatccgaccccgccgctgtggattaaaaccgaactggaagtgctgtttcagggcccggaacagaaactgattagcgaagaagatctgaccagcgcggtggatcatcaccatcatcaccattaa BBa_K1915998_sequence 1 tactagatg BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca BBa_K1915999_sequence 1 tcatagagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z