BBa_K1919000 1 BBa_K1919000 The coding sequence of antimicrobial peptide CecropinXJ 2016-09-03T11:00:00Z 2016-09-07T07:47:30Z The original sequence of CecropinXJ comes from GenBank NM_001043995.1. Antimicrobial peptide CecropinXJ belongs to AMP family Cecropin, a group of small basic polypeptides mainly found in the hemolymph of insects, consist of 31-39 amino acid residues and have a broad spectrum, high heat stability and potent bacteriostatic activity. false false _2386_ 26103 26103 9 false The coding sequence was optimized for E.coli expression using JCat http://www.jcat.de/. The single stop codon was replaced by double TAA stop codon. false Shiji Zhao annotation2482449 1 ATG start codon range2482449 1 1 3 annotation2482451 1 double TAA stop codon range2482451 1 190 195 annotation2482450 1 CecropinXJ coding sequence range2482450 1 1 195 BBa_K1919000_sequence 1 atgaacttcgctaaaatcctgtctttcgttttcgctctggttctggctctgtctatgacctctgctgctccggaaccgcgttggaaaatcttcaaaaaaatcgaaaaaatgggtcgtaacatccgtgacggtatcgttaaagctggtccggctatcgaagttctgggttctgctaaagctatcggtaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z