BBa_K1919001 1 BBa_K1919001 Constitutive promotor J23105 and downstream CecropinXJ 2016-09-04T11:00:00Z 2016-10-14T08:28:15Z The sequence of constitutive promotor J23105 comes from biobrick BBa_J23105. RBS and 5 downstream tags come from commercial plasmid pET32a(+). The sequence of CecropinXJ comes from biobrick BBa_K1919000. Biobrick BBa_K1919001 is a composite part, consisting of constitutive promotor J23105, RBS, TrxA tag, 6xHis tag, thrombin site, S tag, enterkinase site and the coding sequence of antimicrobial peptide CecropinXJ. false false _2386_ 26103 26103 9 false Two steps were needed in order to obtain BBa_K1919001. Step 1, BBa_K1919000 was inserted into pET32a(+). The primers used for PCR are as following: F: 5'-CCGGGATCCATGAACTTCGCTAAAATCCTGTCTT-3' (BamH I site was added) R: 5'-CCGCTCGAGTTATTATTTACCGATAGCTTTA-3' (Xho I site was added) BamH I/Xho I Double enzymatic cutting was used for both pET32a(+) and BBa_K1919000. Step 2, RBS and 5 downstream tags as well as original CecropinXJ was inserted at the downstream of promotor J23105 with the same procedure as step 1. The primers used for PCR are as following: F: 5'-GCTCTAGAGCGAAGGAGATATACATATGAGCG-3' (Xba I site was added) R: 5'-TGCACTGCAGTGCAGACTAGTCGTTATTGCTCAGCGGTGG-3'(Pst I site was added) Xba I/Pst I double enzymatic cutting was used for PCR product and Spe I/Pst I double enzymatic cutting was used for BBa_J23105. After enzymatic linkage, the construction of BBa_K1919001 was finished. Then this part was added to pSB1C3 backbone. false Shiji Zhao annotation2482475 1 6xHis Tag range2482475 1 408 425 annotation2482470 1 CecropinXJ coding sequence range2482470 1 555 749 annotation2482474 1 TrxA range2482474 1 60 386 annotation2482473 1 RBS range2482473 1 46 51 annotation2482471 1 double TAA stop codon range2482471 1 744 749 annotation2482468 1 BBa_J23105 range2482468 1 1 35 annotation2482478 1 enterokinase site range2482478 1 519 533 annotation2482469 1 ATG start codon range2482469 1 60 62 annotation2482472 1 BBa_K1919000 range2482472 1 555 749 annotation2482476 1 thrombin site range2482476 1 435 452 annotation2482477 1 S-Tag range2482477 1 459 503 BBa_K1919001_sequence 1 tttacggctagctcagtcctaggtactatgctagctactagagcgaaggagatatacatatgagcgataaaattattcacctgactgacgacagttttgacacggatgtactcaaagcggacggggcgatcctcgtcgatttctgggcagagtggtgcggtccgtgcaaaatgatcgccccgattctggatgaaatcgctgacgaatatcagggcaaactgaccgttgcaaaactgaacatcgatcaaaaccctggcactgcgccgaaatatggcatccgtggtatcccgactctgctgctgttcaaaaacggtgaagtggcggcaaccaaagtgggtgcactgtctaaaggtcagttgaaagagttcctcgacgctaacctggccggttctggttctggccatatgcaccatcatcatcatcattcttctggtctggtgccacgcggttctggtatgaaagaaaccgctgctgctaaattcgaacgccagcacatggacagcccagatctgggtaccgacgacgacgacaaggccatggctgatatcggatccatgaacttcgctaaaatcctgtctttcgttttcgctctggttctggctctgtctatgacctctgctgctccggaaccgcgttggaaaatcttcaaaaaaatcgaaaaaatgggtcgtaacatccgtgacggtatcgttaaagctggtccggctatcgaagttctgggttctgctaaagctatcggtaaataataactcgagcaccaccaccaccaccactgagatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z