BBa_K1919100 1 BBa_K1919100 The device consist of temperature promotor and hokD coding gene. 2016-10-13T11:00:00Z 2016-10-18T09:59:58Z we acquired that two parts BBa_K608351 and BBa_K1497008 we based on on igem distribution plates and constructed the composite device through molecular biology technique. This device is a combination of two parts submitted by previous igem teams that one （BBa_K608351） is a temperature-regulated promoter followed by the other （BBa_K1497008 ）that a gene coding for a protein hokD which induces cell lysis. The promoter we chose won???t start translation until the temperature is raised to 37℃. And at 42℃ can we get the peck efficiency of expression. The promoter is in fact a composite sequence that preceding the regulated promoter is the control sequence which can synthesis λ cI repressor. λ cI repressor binds with the promoter sequence when environment temperature is 28~30℃ while at 42℃, the protein denatures and falls off by which initiate the transcription. We use the temperature-regulated promoter to express hokD gene. The hokD gene of??E. coli??transcribes for a small polypeptide that causes cell death by elimination of vital cell wall functions. In short , our device can induce cell lysis when temperature is raised to 42℃. To deliver the antimicrobial peptides in the right place and at the right time, we designed and constructed this temperature-regulated device. When put under the sole of feet, our peptide-expressing E.coli cells in the insole would be incubated at a warmer environment due to body temperature. We use this promoter to control the synthesis of hokD for the raised temperature will promote the translation of hokD which following the promoter. false false _2386_ 27466 27466 9 false We use pSB1C3 vector to express this device for its more avaliable. false Zekun Lv annotation2501464 1 BBa_K608351 range2501464 1 1 948 annotation2501707 1 BBa_K1497008 range2501707 1 956 1112 BBa_K1919100_sequence 1 tttatggctagctcagtcctaggtacaatgctagctactagagaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggctgactccagcggccgctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagagtaacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagatgaagcagcaaaaggcgatgttaatcgccctgatcgtcatctgtttaaccgtcatagtgacggcactggtaacgaggaaagacctctgcgaggtacgaatccgaaccggccagacggaggtcgctgtcttcacagcttacgaacctgaggagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z