BBa_K1920006 1 BBa_K1920006 pBAD-RBS-lysis-B0015 2016-09-22T11:00:00Z 2016-10-14T09:06:20Z Provided by our advisor, I-Son Ng. pBAD is an E.coli promoter that is induced by L-arabinose.In the absence of arabinose, the repressor protein AraC (BBa_I13458) binds to the AraI1 operator site of pBAD and the upstream operator site AraO2, blocking transcription [1]. In the presence of arabinose, AraC binds to it and changes its conformation such that it interacts with the AraI1 and AraI2 operator sites, permitting transcription [1].[***] However, under the higher concentration of glucose environment, pBAD will be inhibited[***]. But there is still a proper range of glucose concentration, allowing us to control the expression of the lysis. false false _2387_ 29619 29627 9 true For biosafety, we need to precisely control the expression of lysis. So we choose the pBAD which is an promoter induced by L-arabinose. false Chia-En,Wong component2484587 1 BBa_B0015 component2484577 1 BBa_K206000 component2484580 1 BBa_K117000 component2484579 1 BBa_B0034 annotation2484587 1 BBa_B0015 range2484587 1 309 437 annotation2484580 1 BBa_K117000 range2484580 1 157 300 annotation2484577 1 BBa_K206000 range2484577 1 1 130 annotation2484579 1 BBa_B0034 range2484579 1 139 150 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K117000 1 BBa_K117000 Lysis gene (promotes lysis in colicin-producing bacteria strain) 2008-10-06T11:00:00Z 2015-05-08T01:09:34Z to be updated Released HQ 2013 This lysis gene encodes for the lysis protein in colicin-producing strains of bacteria. Once activated, it causes the host cell to lyze. It also removes the immunity protein out of colicin, and hence, activates the endonuclease activity of the colicin. false false _209_ 0 2774 9 In stock true to be updated true Nguyen Xuan Hung BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K206000 1 pBAD pBAD strong 2009-10-13T11:00:00Z 2015-05-08T01:11:23Z The sequence was obtained by applying all mutations that upregulated AraC binding and subsequent promoter activity listed in reference [1]. Released HQ 2013 pBAD is an <i>E.coli</i> promoter that is induced by L-arabinose. K206000 is a mutagenized pBAD promoter that is responsive to lower concentrations of arabinose than wild type (<partinfo>I13453</partinfo>) and, additionally, exhibits a higher maximum of protein expression as measured by coupling to a fluorescent reporter. false false _307_ 0 4172 9 In stock true There were no special design considerations. false Amelia Hardjasa annotation2049253 1 AraI1 range2049253 1 40 57 annotation2049252 1 promoter range2049252 1 1 131 annotation2049254 1 AraI2 range2049254 1 61 78 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K117000_sequence 1 atgaaaaaaataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagggcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaa BBa_K1920006_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagaaagaggagaaatactagatgaaaaaaataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagggcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K206000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z