BBa_K192001 1 BBa_K192001 CFP +tgt +lva 2009-09-14T11:00:00Z 2015-05-08T01:11:15Z Part was synthesized. CFP with targeting sequence and LVA tag. The targeting sequence targets the protein to the encapsulin nanocompartment [1] with the aim of increasing the half-life of the protein. LVA should help limit the amount of background activity. [1] M. Sutter, et al., "Structural basis of enzyme encapsulation into a bacterial nanocompartment," Nat. Struct. & Mol. Biol., vol. 15, pp. 939-47., 2008. false false _297_ 0 2231 9 Not in stock false We decided to position the LVA at the C-terminus of the construct since that is its natural position. However, the tgt extension sequence is also typically found at the C-terminus, so we're hoping that the shorter LVA sequence won't interfere too much with the binding with encapsulin. If necessary, it'll be possible to remove the LVA tag via PCR. false Daniel Wong, Kenny Zhan, Jason An annotation2020960 1 double stop range2020960 1 853 858 annotation2020963 1 lva range2020963 1 820 852 annotation2020962 1 tgt range2020962 1 718 819 annotation2020961 1 cfp range2020961 1 4 717 annotation2020959 1 start range2020959 1 1 3 BBa_K192001_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagctcagaacttacctgttcacggacaagccgatcacagaaatcgaagaagaaacgtccggtggatcagaaaacacgggtggagacctcggcataaggaagctcgctgcaaacgacgaaaactacgctttagtagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z