BBa_K1925001 1 hTERT human Telomerase reverse transcriptase Promoter 2016-10-07T11:00:00Z 2016-10-13T11:11:19Z PCR from human genomic.The genome is a gift from Daru Lu's labortary. Tihis is the promoter of human Telomerase reverse transcriptase,after which genes are expressed only in pluripotent cells and cancer cells theoretically.Using restriction enzymes to cut or PCR from biobrick,then putting it on the upstream of genes of interest is available ways to use the element. false false _2392_ 29381 29381 9 false the length of the Promoter,and its leakiness false Zi Yue Wang annotation2491099 1 hTERT range2491099 1 1 416 BBa_K1925001_sequence 1 cccgcacgcacctgttcccagggcctccacatcatggcccctccctcgggttaccccacagcctaggccgattcgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggggaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggattcgcgggcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcacccgtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccgggtccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctaggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z