BBa_K1925002 1 BBa_K1925002 Tetracycline-responsed U6 promoter 2016-10-10T11:00:00Z 2016-10-13T11:22:45Z a gift from Ni Ting lab If you want to use tet-off or tet-on system to selectively express a RNA(lincRNA\shRNA) rather than a protein-coding gene,this Tetracycline-responsed promoter can be an best choice cuz it's a pol III type promoter.Comparing with tradtional Tetracycline-responsed CMV promoter,it's more suitable for RNA expression. false false _2392_ 29381 29381 9 false the expressed sequence should begin with A. false Zi Yue Wang annotation2491759 1 tet operator range2491759 1 191 209 annotation2491743 1 tet operator range2491743 1 13 31 annotation2491760 1 tet operator range2491760 1 227 245 annotation2491742 1 tetO-U6 range2491742 1 1 338 annotation2491748 1 tet operator range2491748 1 84 102 annotation2491758 1 tet operator range2491758 1 156 174 annotation2491757 1 tet operator range2491757 1 120 138 annotation2491749 1 tet operator range2491749 1 49 67 BBa_K1925002_sequence 1 acttgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttatccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgaggtaggcgtgtacggtcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z