BBa_K1926003 1 BBa_K1926003 A cyclic promoter of CDK4 from human genome 2016-10-08T11:00:00Z 2016-10-19T01:16:14Z The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers: pCDK4-F: TGGTGGAGCGAAAAGGTGACAGCATC pCDK4-R: GCGGAAACTGGGAGGGCGGGGCGAA (Product: 457) This part is a cyclic promoter named CDK4 from human genome. It can lead to transcription of the downstream DNA sequence in every G1 phase[4]. 4. Guo, Z.Y., et al., The elements of human cyclin D1 promoter and regulation involved. Clin Epigenetics, 2011. 2(2): p. 63-76. You may use this part to: 1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line; 2) Use it as a human promoter by transient transfecting it into cells. false false _2393_ 28998 28998 9 false None false Xinyi Liu annotation2491731 1 mutate C into A to remove Pst1 range2491731 1 284 284 annotation2491730 1 P CDK4 range2491730 1 65 522 BBa_K1926003_sequence 1 gcagtttggactagcattctaccgggtaggggaggcgcttttcccaaggcagtctggagcatgctggtggagcgaaaaggtgacagcatcacctctggtaccccaactcccaccccctccccaatgcagacaggctgaaagaccggtagtgagactggagttcagccttcagaccggtagtgagacaatccttcagccgggagttgggctctgggtggcctaggttgccatggcaccgcctcgggctccaccctctcttgtccccctcaccgctccccccctgaagcgggggttgtggcagccagtcacgtgcccgccgcgtagccacacctctgctcctcagagcaatgtcaagcggtcacgtgtgatagcaacagatcacgtggctgccatcgcccctccgcccccttacactcttcgccctcctcccagtcgaagcacctcctgtccgcccctcagcgcatgggtggcggtcacgtgcccagaacgtccggcgttcgccccgccctcccagtttccgcgctagctagctcgaggttatcaaacaagtttgtacaaaaaagctgaacgagaaacgtaaaatgatatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z