BBa_K1926011 1 BBa_K1926011 The SNAP UNIT: SNAP-tag flanked by loxP 2016-10-08T11:00:00Z 2016-10-19T01:22:24Z The SNAP-tag?? was brought from NEB company. NLS and sv40 terminator were got from commercial plasmid: pentry nls GFP/pcdna3.1. This part is the SNAP UNIT of cyclebow system including an sv40 nuclear location sequence (NLS), a covalent labeling of fusion proteins named SNAP-tag?? and an sv40 terminator flanked by homodromous recognition site of recombinase CRE named loxP. The whole part can be cut off by CRE. You may use this part to: 1) Localize proteins in vivo with BLOCK and dye from NEB company; 2) Dye after blocking, you are able to see whether an event have an influence on the localization and expression of the interested protein; 3) Fast cut off this part by transient transfecting recombinase gene into nucleus. false false _2393_ 28998 28998 9 false None false Xinyi Liu annotation2491778 1 NLS range2491778 1 38 58 annotation2491738 1 SNAP-tag range2491738 1 59 604 annotation2491851 1 TAA range2491851 1 626 628 annotation2491776 1 loxP range2491776 1 755 788 annotation2491779 1 sv40 terminator range2491779 1 605 754 annotation2491774 1 loxP range2491774 1 1 34 BBa_K1926011_sequence 1 ataacttcgtatagcatacattatacgaagttatatgcctaagaagaagaggaaggtcatggacaaagactgcgaaatgaagcgcaccaccctggatagccctctgggcaagctggaactgtctgggtgcgaacagggcctgcaccgtatcatcttcctgggcaaaggaacatctgccgccgacgccgtggaagtgcctgccccagccgccgtgctgggcggaccagagccactgatgcaggccaccgcctggctcaacgcctactttcaccagcctgaggccatcgaggagttccctgtgccagccctgcaccacccagtgttccagcaggagagctttacccgccaggtgctgtggaaactgctgaaagtggtgaagttcggagaggtcatcagctacagccacctggccgccctggccggcaatcccgccgccaccgccgccgtgaaaaccgccctgagcggaaatcccgtgcccattctgatcccctgccaccgggtggtgcagggcgacctggacgtggggggctacgagggcgggctcgccgtgaaagagtggctgctggcccacgagggccacagactgggcaagcctgggctgggtcaacatgttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgaggtaataacttcgtatagcatacattatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z