BBa_K1928003 1 BBa_K1928003 toehold switch sensor to detect HCV 1b RNA 2016-10-11T11:00:00Z 2016-10-17T06:09:21Z The toehold sequence is complementary to a part of HCV 1b RNA. Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(CTAGTTGGGCGAGTTACGGACCTCTAAACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 1b RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 1b. false false _2395_ 29996 29996 9 false n order to offer a sequence-specific detection, when we design the toehold, we focused on the region of HCV RNA which encodes the virus??? nucleocapsid due to its high specificity and low mutation rate. Moreover, it is safe in lab conditions. Considering not all regions of HCV RNA were suitable because of the complex structure, we used a software to predict its secondary structure and picked four short sequences that were likely to be ideal for detection of HCV 1b and HCV 2a respectively. We then performed a BLAST search of the sequence, and the results showed that they were highly specific to each genotype of HCV. The toehold sequence of this toehold switch is complementary to one of the eight short sequences. false Xu RuiBing annotation2493809 1 RBS range2493809 1 35 45 annotation2493810 1 start codon range2493810 1 50 52 BBa_K1928003_sequence 1 tttgcattgtggttggcggcgggtgtcctgaaaaggaaacaggacaggaatgccgccgccaacctggcggcagcgcaaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z