BBa_K1930001 1 message Encrypted message sequence 2016-10-15T11:00:00Z 2016-10-16T04:40:07Z Created by our CryptoGErM software. http://2016.igem.org/Team:Groningen/Encoding The iGEM team Groningen 2016 worked on bioencryption in order to safely store data in DNA. In our project we were mainly working with two sequences of DNA which were the encrypted message sequence and the encryption key sequence. The message sequence was created by our software. It is therefore artificial DNA. We ordered the encrypted message sequence as gBlock from IDT (Integrated DNA technologies). false false _2397_ 29748 29748 9 false The iGEM team Groningen 2016 worked on bioencryption in order to safely store data in DNA. In our project we were mainly working with two sequences of DNA which were the encrypted message sequence and the encryption key sequence. The message sequence was created by our software. It is therefore artificial DNA. We ordered the encrypted message sequence as gBlock from IDT (Integrated DNA technologies). false Barbora Waclawikova annotation2513401 1 message sequence range2513401 1 1 555 BBa_K1930001_sequence 1 gaccaagcctgcaaaaacaaagtgcaaagatatcagtaaggtcttaaaggccgaagcggtggcctaagataaaactgggcgccctggcgttagttccgcagaagataaaactgggctaaggcatcaaagaaggtatctaaatccgaagtagttagctaagtgattggcgggcgaaggaatttgctaagctatgaaggattggactaagccattcccgaagctatcacataagcgatgacatgcaccgcagcagacaggtacaaataagaaaactttgaagtctttaagaattagtattaagaagtgatgaagggctatgccaccctcctagagacagctataagctcttaaggagtgaagctgttgaataaggcgtagtagaagcaattaagtcctgaagttctgaagctgttgacgaagataaaactctgaataataagacctactataagtgctgaagcgttgaagagataagacagagaagtcttgaagtgcttaaagaagccttcaactaagtgattacactgctaagagatgaagcattgcacccaccgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z