BBa_K1930005 1 P<sub>AtpI P_AtpI 2016-10-15T11:00:00Z 2016-10-16T04:58:48Z Ordered as gBlock. IDT (Integrated DNA technologies). The promoter P_AtpI has its origin in <em>Bacillus subtilis</em>. It is responsible for the expression of atpA gene (ATP synthesis) during the first 30 min of germination [https://www.ncbi.nlm.nih.gov/pubmed/25661487 Sinai''et al.'']. This gene is part of an operon, therefore the promoter region in front of the first protein coding gene (atpI) in this operon was chosen. The region was checked for the binding of sigma factors and transcription factors with DBTBS. No binding factors were found with the highest significance level. In our project we wanted to find a constitutive ON promoter for our ciprofloxacin resistance casette. In the following part we put the promoter P_AtpI in the pSB1C3 backbone to make it available to other iGEM teams. false false _2397_ 29748 29748 9 false The promoter P_AtpI has its origin in <em>Bacillus subtilis</em>. It is responsible for the expression of atpA gene (ATP synthesis) during the first 30 min of germination [https://www.ncbi.nlm.nih.gov/pubmed/25661487 Sinai''et al.'']. This gene is part of an operon, therefore the promoter region in front of the first protein coding gene (atpI) in this operon was chosen. The region was checked for the binding of sigma factors and transcription factors with DBTBS. No binding factors were found with the highest significance level. In our project we wanted to find a constitutive ON promoter for our ciprofloxacin resistance casette. In the following part we put the promoter P_AtpI in the pSB1C3 backbone to make it available to other iGEM teams. false Eike Mahlandt annotation2513454 1 P(AtpI) range2513454 1 1 349 BBa_K1930005_sequence 1 tataggtgaaaatgtgaacattctgtggagacgtaaagtataaaaagttttttaactttaaacagattgacacatgttaggggctattgtatgctaaacgagggtattatgagaaggttttcatagctttcattatagtcctcatcctcaatgtaaatcctctcagcaaacccgtattatgaggatttatttaagcgaatgaaacagcatccctgcaaggcttgcggatgaatgattttttcgaacaggcccgttttgccggtcaaaaaaggtcttctactaagggttaaccgctgatttttgccgtatccaagctatacattattttttcatcaggagacagataattg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z