BBa_K1932000 1 BBa_K1932000 A promoter and an RBS of the B.<i>longum</i> <i>hup</i> gene. 2016-10-13T11:00:00Z 2016-10-19T03:09:28Z the genomic DNA of Bifidobacterium longum BBa_1932000 contains a part of the hup gene. This gene was cloned from Bifidobacterium to express the HU family protein, HB1, and it consisted a promoter, an RBS, a structural gene and a terminator. Our part was constructed to up-regulate the expression of the protein in Bifidobacterium. false false _2399_ 31111 31111 9 false 1&#12289;Restriction enzyme cutting sites were identified. 2&#12289;The sequence of strong promoter was assured false Jin Liu annotation2512761 1 Hup range2512761 1 1 116 BBa_K1932000_sequence 1 agatgtgaaaacccttataaaacgcgggttttcgcagaaacatgcgctagtatcattgatgacaacatggactaagcaaaagtgcttgtcccctgacccaagaaggatgctttatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z