BBa_K1932002 1 BBa_K1932002 SEC2 signal peptides 2016-10-13T11:00:00Z 2016-10-19T02:13:44Z sequenced genome of B. breve UCC2003 Sec2 is predicted to contain a classical SP with a single transmembrane region. The portion of this protein fused to the nuclease comprises the first 77 amino acids of a putative 602-amino-acid protein. This protein is significantly similar to the permease component of an ABC-type transport system, and clear homologues of the gene are found in B. longum NCC2705 (accession no. NP_695398) and DJO10A (ZP_00121339) false false _2399_ 31111 31111 9 false （1）The restriction enzyme cutting sites were excluded. （2）The protein region that directs the export was confirmed. false Jin Liu annotation2512805 1 sec2 signal peptide range2512805 1 1 134 BBa_K1932002_sequence 1 atggaacatatgaagatgttccggcgcctatcctccgttgtcgttattgtgctgctgatgccgctcatactggtggccatgccggttcccgccgcgcaagccgaccagctgcccaaccccgactgggtggcattg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z