BBa_K1932003 1 BBa_K1932003 TMP1 signal peptides, hypothetical protein 2016-10-13T11:00:00Z 2016-10-16T03:56:14Z sequenced genome of B. breve UCC2003 TMP1 is a polypeptide containing at least one predicted transmembrane domain were identified as active ΔSPNuc fusions and were designated Tmp (for putative transmembrane protein).The fused portion of Tmp1 corresponds to the N-terminal region of a hypothetical protein and is predicted to have a C-out topology, which is expected for transmembrane proteins (Nuc activity of a fusion indicates that the ΔSPNuc domain is exported). Proteins similar to Tmp1 have been found only in B. longum NCC2705 (accession no. NP_696268) and DJO10A (ZP_00120937), although no function has been assigned to these proteins. false false _2399_ 31111 31111 9 false （1）The restriction enzyme cutting sites were excluded. （2）The protein region that directs the export was confirmed. false Jin Liu annotation2512804 1 TMP1 signal peptide range2512804 1 1 198 BBa_K1932003_sequence 1 atgacactgatggcaggccgggaaagaaggtcgatgatgactggtgcacaggcttctcactgtggttccgtatccgcaatttcactgggactgcctgtttccacggcgattccggaggccaagggcatattgccgaaggctctgttcgtgggcaaagcgccgatttccggcaagcttaagcagcggtttgtgaatgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z