BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_K193200 1 AntiFreeze TmTHP is one of Anti-Freeze Protein 2009-10-13T11:00:00Z 2015-05-08T01:11:15Z The gene sequence was obtained from Mr.GENE. TmTHP codes Anti-Freeze Protein. false false _288_ 0 4081 9 Not in stock false none. false Nao Nakatani BBa_K193201 1 RBS+TmTHP Anti-Freeze Protein with RBS 2009-10-13T11:00:00Z 2015-05-08T01:11:15Z We used B0030 and K193200. RBS with located upstream Anti-Freeze Protein. false false _288_ 0 4081 9 Not in stock false We used biobrick standard assembly. false Nao Nakatani component2040898 1 BBa_K193200 component2040896 1 BBa_B0030 annotation2040898 1 BBa_K193200 range2040898 1 24 314 annotation2040896 1 BBa_B0030 range2040896 1 1 15 BBa_K193201_sequence 1 attaaagaggagaaatactagagtgtccatggctggatccgatcgatcccagtgcaccggtggtgctgactgcaccagctgcaccgctgcttgcaccggttgcggtaactgcccgaacgctgttacttgcactaacagccagcactgcgttaaagctaccacctgcaccggtagcaccgactgcaacaccgctgttacctgcactaactctaaagactgcttcgaagctcagacctgcaccgactctaccaactgctacaaagctaccgcttgcaccaactctaccggctgcccgggtcacgatcgatcttaat BBa_B0030_sequence 1 attaaagaggagaaa BBa_K193200_sequence 1 tgtccatggctggatccgatcgatcccagtgcaccggtggtgctgactgcaccagctgcaccgctgcttgcaccggttgcggtaactgcccgaacgctgttacttgcactaacagccagcactgcgttaaagctaccacctgcaccggtagcaccgactgcaacaccgctgttacctgcactaactctaaagactgcttcgaagctcagacctgcaccgactctaccaactgctacaaagctaccgcttgcaccaactctaccggctgcccgggtcacgatcgatcttaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z