BBa_K1933000 1 BclA-His N-terminal domain of BclA protein fused to 6xHis tag 2016-10-09T11:00:00Z 2016-10-17T12:19:04Z NCBI accession number CAD56880 NCBI accession number CAD56878 NCBI accession number CAD56869 NCBI accession number CAD56870 This part codes N-terminal domain of BclA protein which expressed on the cell surface connected by a 6??His tag to be easily identified by Western blotting.[1] Surface displayed passengers retain enzyme activity even when it is linked to BclA with 6?? His tag. false false _2400_ 23701 29998 9 false optimized to expression in E. coli K-12 strain false Tomoki Uchino annotation2490250 1 6xHis tag range2490250 1 67 84 annotation2490249 1 BclA range2490249 1 4 66 annotation2490248 1 start codon range2490248 1 1 3 BBa_K1933000_sequence 1 atggcgttcgacccgaacctggttggtccgaccctgccgccgatcccgccgttcaccctgccgacccatcatcatcatcatcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z