BBa_J23105 1 BBa_J23105 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1933000 1 BclA-His N-terminal domain of BclA protein fused to 6xHis tag 2016-10-09T11:00:00Z 2016-10-17T12:19:04Z NCBI accession number CAD56880 NCBI accession number CAD56878 NCBI accession number CAD56869 NCBI accession number CAD56870 This part codes N-terminal domain of BclA protein which expressed on the cell surface connected by a 6??His tag to be easily identified by Western blotting.[1] Surface displayed passengers retain enzyme activity even when it is linked to BclA with 6?? His tag. false false _2400_ 23701 29998 9 false optimized to expression in E. coli K-12 strain false Tomoki Uchino annotation2490248 1 start codon range2490248 1 1 3 annotation2490250 1 6xHis tag range2490250 1 67 84 annotation2490249 1 BclA range2490249 1 4 66 BBa_K1933003 1 BBa_K1933003 constitutive expression of CBDclos fused to BclA with 6xHis tag 2016-10-09T11:00:00Z 2016-10-10T08:34:03Z The BclA surface expression component derives from Bacillus anthracis(34F2), it is a hair-like protein that covers B. anthracis??? spores. We used parts BBa_K1933000 from iGEMKyoto 2016 for construction. We outsourced chemical synthesis of this part for construction. CBDclos derives from Clostridium cellulovorans, and is part of a multi-unit cellulosomes. We used parts BBa_K1321341 from iGEM Imperial 2014 for construction. CBDclos fused to BclA with 6xHis tag is one of a series of surface expressing fusion proteins that make up biodevice that aims to be therapeutic solution against norovirus infections. This protein in particular is a cellulose binding protein(CBD) fused to surface expression anchoring domain(BclA), connected by a 6xHis tag to be easily identified by Western blotting. For more information, please visit our <a ref=http://2016.igem.org/Team:Kyoto> Wiki page</a>. true false _2400_ 29998 29998 9 false BclA sequence was optimized to expression in E. coli K-12 false Tomoki Uchino component2490215 1 BBa_K1933000 component2490210 1 BBa_B0034 component2490216 1 BBa_K1321002 component2490208 1 BBa_J23105 annotation2490210 1 BBa_B0034 range2490210 1 36 47 annotation2490208 1 BBa_J23105 range2490208 1 1 35 annotation2490215 1 BBa_K1933000 range2490215 1 48 137 annotation2490216 1 BBa_K1321002 range2490216 1 138 437 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1321002 1 BBa_K1321002 Re-entry of BBa_K863111, Cellulose Binding Domain CBDclos in rfc25 2014-10-09T11:00:00Z 2015-06-17T12:35:41Z This is a direct copy of BBa_K863111 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. This part is a copy of BBa_K863111 (Cellulose binding domain of C. cellulovorans cellulose binding protein gene (Freiburg-Standard)) and was created only as a registry entry, removing the atg-NgoMIV parts at the front and the AgeI-taa basepairs from the sequence so that the registry does not flag it as rfc25 incompatible, and it enables us to enter fusion proteins with this part as automatic composite parts in the method as described by: http://2009.igem.org/Team:Freiburg_bioware/general. false false _1696_ 4206 20780 9 Not in stock false This is a direct copy of BBa_K863111 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. false Xenia Spencer-Milnes BBa_B0034_sequence 1 aaagaggagaaa BBa_J23105_sequence 1 tttacggctagctcagtcctaggtactatgctagc BBa_K1933000_sequence 1 atggcgttcgacccgaacctggttggtccgaccctgccgccgatcccgccgttcaccctgccgacccatcatcatcatcatcat BBa_K1933003_sequence 1 tttacggctagctcagtcctaggtactatgctagcaaagaggagaaaatggcgttcgacccgaacctggttggtccgaccctgccgccgatcccgccgttcaccctgccgacccatcatcatcatcatcattaataatcatcaatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaattactaacacgtctgacagtgatttaaatttaaatgacgtaaaagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaggcagc BBa_K1321002_sequence 1 tcatcaatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaattactaacacgtctgacagtgatttaaatttaaatgacgtaaaagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaggcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z