BBa_K1933004 1 BBa_K1933004 constitutive promoter and RBS 2016-10-09T11:00:00Z 2016-10-10T09:38:21Z BBa_J23105 was designed by John Anderson and BBa_B0034 was designed by Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. This sequence was chemically synthesized. This part codes costitutive promoter(BBa_J23105) and RBS(BBa_B0034). Most parts were expressioned by this part in our project. false false _2400_ 29998 29998 9 false 7bp after promoter and 6bp after RBS false Tomoki Uchino annotation2490322 1 nonsense sequence range2490322 1 36 42 annotation2490408 1 constitutive promoter and RBS range2490408 1 1 60 annotation2490404 1 Re-entry of BBa_B0034 range2490404 1 43 54 annotation2490405 1 scar range2490405 1 55 60 annotation2490323 1 Re-entry of BBa_J23105 range2490323 1 1 35 BBa_K1933004_sequence 1 tttacggctagctcagtcctaggtactatgctagcactagagaaagaggagaaatactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z