BBa_K1933004 1 BBa_K1933004 constitutive promoter and RBS 2016-10-09T11:00:00Z 2016-10-10T09:38:21Z BBa_J23105 was designed by John Anderson and BBa_B0034 was designed by Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. This sequence was chemically synthesized. This part codes costitutive promoter(BBa_J23105) and RBS(BBa_B0034). Most parts were expressioned by this part in our project. false false _2400_ 29998 29998 9 false 7bp after promoter and 6bp after RBS false Tomoki Uchino annotation2490322 1 nonsense sequence range2490322 1 36 42 annotation2490323 1 Re-entry of BBa_J23105 range2490323 1 1 35 annotation2490405 1 scar range2490405 1 55 60 annotation2490408 1 constitutive promoter and RBS range2490408 1 1 60 annotation2490404 1 Re-entry of BBa_B0034 range2490404 1 43 54 BBa_K1933000 1 BclA-His N-terminal domain of BclA protein fused to 6xHis tag 2016-10-09T11:00:00Z 2016-10-17T12:19:04Z NCBI accession number CAD56880 NCBI accession number CAD56878 NCBI accession number CAD56869 NCBI accession number CAD56870 This part codes N-terminal domain of BclA protein which expressed on the cell surface connected by a 6??His tag to be easily identified by Western blotting.[1] Surface displayed passengers retain enzyme activity even when it is linked to BclA with 6?? His tag. false false _2400_ 23701 29998 9 false optimized to expression in E. coli K-12 strain false Tomoki Uchino annotation2490249 1 BclA range2490249 1 4 66 annotation2490248 1 start codon range2490248 1 1 3 annotation2490250 1 6xHis tag range2490250 1 67 84 BBa_K1933102 1 BBa_K1933102 constitutive expression of CBDcex fused to BclA with 6xHis tag 2016-10-09T11:00:00Z 2016-10-10T12:04:53Z Promoter and RBS:BBa_K1933004 <br><br>The BclA surface expression component derives from Bacillus anthracis(34F2), it is a hair-like protein that covers B. anthracis??? spores. We used parts BBa_K1933000 from iGEMKyoto 2016 for construction. We outsourced chemical synthesis of this part for construction. <br>CBDcex derives from Cellulomonas fimi, and is part of an exoglucanase secreted by this organism. We used parts BBa_K1321342 from iGEM Imperial 2014 for construction. CBDcex fused to BclA with 6xHis tag is one of a series of surface expressing fusion proteins that make up biodevice that aims to be therapeutic solution against norovirus infections. This protein in particular is a cellulose binding protein(CBD) fused to surface expression anchoring domain(BclA), connected by a 6xHis tag to be easily identified by Westernblotting. For more information, please visit our <a ref=http://2016.igem.org/Team:Kyoto> Wiki page</a>. false false _2400_ 23701 29998 9 false The stop codon for this part is not in the coding region, but in the suffix region. false Tomoki Uchino component2491092 1 BBa_K1321003 component2491087 1 BBa_K1933004 component2491091 1 BBa_K1933000 annotation2491092 1 BBa_K1321003 range2491092 1 145 471 annotation2491091 1 BBa_K1933000 range2491091 1 61 144 annotation2491087 1 BBa_K1933004 range2491087 1 1 60 BBa_K1321003 1 BBa_K1321003 Re-entry of BBa_K863101, Cellulose Binding Domain CBDcex in rfc25 2014-10-09T11:00:00Z 2015-06-17T12:35:33Z This is a direct copy of BBa_K863101 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. This part is a copy of BBa_K863101 (Cellulose binding Domain of Cellulomonas Fimi Exoglucanse (Freiburg-Standard)) and was created only as a registry entry, removing the atg-NgoMIV parts at the front and the AgeI-taa basepairs from the sequence so that the registry does not flag it as rfc25 incompatible, and it enables us to enter fusion proteins with this part as automatic composite parts in the method as described by: http://2009.igem.org/Team:Freiburg_bioware/general. false false _1696_ 4206 20780 9 Not in stock false This is a direct copy of BBa_K863101 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. false Xenia Spencer-Milnes BBa_K1321003_sequence 1 ggtccggccgggtgccaggtgctgtggggcgtcaaccagtggaacaccggcttcaccgcgaacgtcaccgtgaagaacacgtcctccgctccggtagacggctggacgctcacgttcagcttcccgtccggccagcaggtcacccaggcgtggagctcgacggtcacgcagtccggctcggccgtgacggtccgcaacgccccgtggaacggctcgatcccggcgggcggcaccgcgcagttcggcttcaacggctcgcacacgggcaccaacgccgcgccgacggcgttctcgctcaacggcacgccctgcacggtcggcggcagc BBa_K1933102_sequence 1 tttacggctagctcagtcctaggtactatgctagcactagagaaagaggagaaatactagatggcgttcgacccgaacctggttggtccgaccctgccgccgatcccgccgttcaccctgccgacccatcatcatcatcatcatggtccggccgggtgccaggtgctgtggggcgtcaaccagtggaacaccggcttcaccgcgaacgtcaccgtgaagaacacgtcctccgctccggtagacggctggacgctcacgttcagcttcccgtccggccagcaggtcacccaggcgtggagctcgacggtcacgcagtccggctcggccgtgacggtccgcaacgccccgtggaacggctcgatcccggcgggcggcaccgcgcagttcggcttcaacggctcgcacacgggcaccaacgccgcgccgacggcgttctcgctcaacggcacgccctgcacggtcggcggcagc BBa_K1933000_sequence 1 atggcgttcgacccgaacctggttggtccgaccctgccgccgatcccgccgttcaccctgccgacccatcatcatcatcatcat BBa_K1933004_sequence 1 tttacggctagctcagtcctaggtactatgctagcactagagaaagaggagaaatactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z