BBa_K1933000 1 BclA-His N-terminal domain of BclA protein fused to 6xHis tag 2016-10-09T11:00:00Z 2016-10-17T12:19:04Z NCBI accession number CAD56880 NCBI accession number CAD56878 NCBI accession number CAD56869 NCBI accession number CAD56870 This part codes N-terminal domain of BclA protein which expressed on the cell surface connected by a 6??His tag to be easily identified by Western blotting.[1] Surface displayed passengers retain enzyme activity even when it is linked to BclA with 6?? His tag. false false _2400_ 23701 29998 9 false optimized to expression in E. coli K-12 strain false Tomoki Uchino annotation2490250 1 6xHis tag range2490250 1 67 84 annotation2490248 1 start codon range2490248 1 1 3 annotation2490249 1 BclA range2490249 1 4 66 BBa_K1933201 1 BBa_K1933201 constitutive expression of anti-Norovirus GII.4 scFv fused to BclA with 6xHis tag 2016-10-09T11:00:00Z 2016-10-10T12:42:57Z Promoter and RBS: The BclA surface expression component derives from Bacillus anthracis(34F2), it is a hair-like protein that covers B. anthracis??? spores. We outsourced chemical synthesis of this part for construction. scFv is made from fusing variable region (VH and VL chain) of a human anti-norovirus antibody with a linker peptide. We have been given the scFv-encoding plasmid (NoV GII.4 strain-specific antibody 12A2 (vector: pSCCA5-E8d)) from Dr. Kyoko Moriguchi of the Fujita Health University Department of Virology Parasitology. anti-Norovirus GII.4 scFv fused to BclA with 6xHis tag is one of a series of surface expressing fusion proteins that make up biodevice that aims to be therapeutic solution against norovirus infections. This protein in particular is a single chained variable fragment(scFv) of a norovirus GII.4 strain fused to surface expression anchoring domain(BclA), connected by a 6xHis tag to be easily identified by Western blotting. For more information, please visit our <a ref=http://2016.igem.org/Team:Kyoto> Wiki page</a>. false false _2400_ 29998 29998 9 false Silent mutation was done to remove PstI site. false Tomoki Uchino component2491146 1 BBa_K1933004 component2491150 1 BBa_K1933000 component2491157 1 BBa_K1933002 annotation2491157 1 BBa_K1933002 range2491157 1 145 924 annotation2491150 1 BBa_K1933000 range2491150 1 61 144 annotation2491146 1 BBa_K1933004 range2491146 1 1 60 BBa_K1933004 1 BBa_K1933004 constitutive promoter and RBS 2016-10-09T11:00:00Z 2016-10-10T09:38:21Z BBa_J23105 was designed by John Anderson and BBa_B0034 was designed by Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. This sequence was chemically synthesized. This part codes costitutive promoter(BBa_J23105) and RBS(BBa_B0034). Most parts were expressioned by this part in our project. false false _2400_ 29998 29998 9 false 7bp after promoter and 6bp after RBS false Tomoki Uchino annotation2490323 1 Re-entry of BBa_J23105 range2490323 1 1 35 annotation2490405 1 scar range2490405 1 55 60 annotation2490408 1 constitutive promoter and RBS range2490408 1 1 60 annotation2490322 1 nonsense sequence range2490322 1 36 42 annotation2490404 1 Re-entry of BBa_B0034 range2490404 1 43 54 BBa_K1933002 1 scFv anti-Norovirus GII.4 scFv 2016-10-09T11:00:00Z 2016-10-18T10:28:59Z We have been given given the scFv-encoding plasmid (NoV GII.4 strain-specific antibody 12A2 (vector: pSCCA5-E8d)) from Dr. Kyoko Moriguchi of the Fujita Health University Department of Virology Parasitology. This part codes anti-Norovirus GII.4 scFv (single-chain variable fragment) which derives from human 12A2 antibody. This scFv is suggested to prevent binding of human norovirus to Hist-Blood Group Antigens. [1] This coding sequence was fused to INPNC-His (part number: ) or BclA-His (part number: ) in our project. For more information, please visit our <a ref=http://2016.igem.org/Team:Kyoto> Wiki page</a>. false false _2400_ 23701 29998 9 true silent mutation was made to remove PstI: G255C false Tomoki Uchino annotation2490183 1 VH range2490183 1 4 392 annotation2490185 1 VL range2490185 1 439 777 annotation2490184 1 linker range2490184 1 393 438 annotation2490182 1 start codon range2490182 1 1 3 annotation2490186 1 stop codon range2490186 1 778 780 annotation2490197 1 G255C range2490197 1 255 255 BBa_K1933000_sequence 1 atggcgttcgacccgaacctggttggtccgaccctgccgccgatcccgccgttcaccctgccgacccatcatcatcatcatcat BBa_K1933201_sequence 1 tttacggctagctcagtcctaggtactatgctagcactagagaaagaggagaaatactagatggcgttcgacccgaacctggttggtccgaccctgccgccgatcccgccgttcaccctgccgacccatcatcatcatcatcatatggccgaggtgcagctggtggagtctgggggaggcttggtacagcctggggggtccctgagactctcctgtgcaacctctgcattcatctttgacaactatcccatgacttgggtccgccaggctcaggctccagggaaggggctggagtgggtcgcaagtattagtggtagtggcggcaggacatactacgcagactccgtgaagggccgcttcaccatctccagagacaattccaagtatgtgttgtttctccagatgaacagcctgagagccgaggacacggccatatattactgtgtgaaatctcctcccgacgtttgggggagtcatcaattcagggattggtactttgactactggggccagggaaccctggtcaccgtctcgagaggcggtggcggatcaggtggcggtggaagtggcggtggtgggtccatggcctcctatgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactataaactggtaccagcagctcccaggaacggcccccaaactcctcatctataataatcatcagcggccctcaggggtccctgaccgattctctggctcaaagtctggcacctcagcctccctggccatcagtgggctccagtctgcggatgaggctgattattactgtggagcgtggaatgacagcctgaatgtctatgtcttcggaactgggaccaaggtcaccgtcctaggttag BBa_K1933002_sequence 1 atggccgaggtgcagctggtggagtctgggggaggcttggtacagcctggggggtccctgagactctcctgtgcaacctctgcattcatctttgacaactatcccatgacttgggtccgccaggctcaggctccagggaaggggctggagtgggtcgcaagtattagtggtagtggcggcaggacatactacgcagactccgtgaagggccgcttcaccatctccagagacaattccaagtatgtgttgtttctccagatgaacagcctgagagccgaggacacggccatatattactgtgtgaaatctcctcccgacgtttgggggagtcatcaattcagggattggtactttgactactggggccagggaaccctggtcaccgtctcgagaggcggtggcggatcaggtggcggtggaagtggcggtggtgggtccatggcctcctatgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactataaactggtaccagcagctcccaggaacggcccccaaactcctcatctataataatcatcagcggccctcaggggtccctgaccgattctctggctcaaagtctggcacctcagcctccctggccatcagtgggctccagtctgcggatgaggctgattattactgtggagcgtggaatgacagcctgaatgtctatgtcttcggaactgggaccaaggtcaccgtcctaggttag BBa_K1933004_sequence 1 tttacggctagctcagtcctaggtactatgctagcactagagaaagaggagaaatactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z