BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_K193403 1 RBS-pcyA-t teminator is located downstream of the BBa_193402 2009-10-12T11:00:00Z 2015-05-08T01:11:16Z We used biobrick standard assembly. strong terminator is located downstream of RBS-pcyA false false _288_ 0 4368 9 Not in stock false We used K193402 and I15009. false HIroshi Shiba component2249801 1 BBa_K193402 component2249808 1 BBa_B0014 annotation2249801 1 BBa_K193402 range2249801 1 1 796 annotation2249808 1 BBa_B0014 range2249808 1 805 899 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_I15009 1 BBa_I15009 phycocyanobilin:ferredoxin oxidoreductase (PcyA) from synechocystis 2004-09-19T11:00:00Z 2015-08-31T04:07:38Z Voigt Lab via Anselm Levskaya Released HQ 2013 Second of two required phycocyanobilin biosynthetic genes. false false _5_ 0 88 7 In stock true true Jeff Tabor annotation1891612 1 PcyA range1891612 1 1 750 annotation2214032 1 Help:Barcodes range2214032 1 751 775 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939311 1 BBa_B0011 range939311 1 50 95 annotation939303 1 BBa_B0012 range939303 1 1 41 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_K193402 1 RBS-pcyA RBS is located upstream of pcyA 2009-10-12T11:00:00Z 2015-05-08T01:11:16Z We used biobrick standard assembly. Released HQ 2013 pcyA is the enzyme, oxidizing&#12288; biliverdin Ixalpha into phycocyanobilin which is the second step of changing heam group into phycocyanobilin. RBS is followed by pcyA in this part. false false _288_ 0 4368 9 In stock false We used B0030 and I15009. false HIroshi Shiba component2244327 1 BBa_I15009 component2244323 1 BBa_B0030 annotation2244327 1 BBa_I15009 range2244327 1 22 796 annotation2244323 1 BBa_B0030 range2244323 1 1 15 BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0030_sequence 1 attaaagaggagaaa BBa_K193402_sequence 1 attaaagaggagaaatactagatggccgtcactgatttaagtttgaccaattcttccctgatgcctacgttgaacccgatgattcaacagttggccctggcgatcgccgctagttggcaaagtttacccctcaagccctatcaattgccggaggatttgggctacgtagaaggccgcctggaaggggaaaagttagtgattgaaaatcggtgctaccaaacgccccagtttcgcaaaatgcatttggagttggccaaggtgggcaaagggttggatattctccactgtgtaatgtttcctgagcctttatacggtctacctttgtttggctgtgacattgtggccggccccggtggagtaagtgcggctattgcggatctatcccccacccaaagcgatcgccaattgcccgcagcgtaccaaaaatcattggcagagctaggccagccagaatttgagcaacaacgggaattgcccccctggggagaaatattttctgaatattgtttattcatccgtcccagcaatgtcactgaagaagaaagatttgtacaaagggtagtggactttttgcaaattcattgtcaccaatccatcgttgccgaacccttgtctgaagctcaaactttggagcaccgtcaggggcaaattcattactgccaacaacaacagaaaaatgataaaacccgtcgggtactggaaaaagcttttggggaagcttgggcggaacggtatatgagccaagtcttatttgatgttatccaataataactctgatagtgctagtgtagatctc BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_I15009_sequence 1 atggccgtcactgatttaagtttgaccaattcttccctgatgcctacgttgaacccgatgattcaacagttggccctggcgatcgccgctagttggcaaagtttacccctcaagccctatcaattgccggaggatttgggctacgtagaaggccgcctggaaggggaaaagttagtgattgaaaatcggtgctaccaaacgccccagtttcgcaaaatgcatttggagttggccaaggtgggcaaagggttggatattctccactgtgtaatgtttcctgagcctttatacggtctacctttgtttggctgtgacattgtggccggccccggtggagtaagtgcggctattgcggatctatcccccacccaaagcgatcgccaattgcccgcagcgtaccaaaaatcattggcagagctaggccagccagaatttgagcaacaacgggaattgcccccctggggagaaatattttctgaatattgtttattcatccgtcccagcaatgtcactgaagaagaaagatttgtacaaagggtagtggactttttgcaaattcattgtcaccaatccatcgttgccgaacccttgtctgaagctcaaactttggagcaccgtcaggggcaaattcattactgccaacaacaacagaaaaatgataaaacccgtcgggtactggaaaaagcttttggggaagcttgggcggaacggtatatgagccaagtcttatttgatgttatccaataataactctgatagtgctagtgtagatctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K193403_sequence 1 attaaagaggagaaatactagatggccgtcactgatttaagtttgaccaattcttccctgatgcctacgttgaacccgatgattcaacagttggccctggcgatcgccgctagttggcaaagtttacccctcaagccctatcaattgccggaggatttgggctacgtagaaggccgcctggaaggggaaaagttagtgattgaaaatcggtgctaccaaacgccccagtttcgcaaaatgcatttggagttggccaaggtgggcaaagggttggatattctccactgtgtaatgtttcctgagcctttatacggtctacctttgtttggctgtgacattgtggccggccccggtggagtaagtgcggctattgcggatctatcccccacccaaagcgatcgccaattgcccgcagcgtaccaaaaatcattggcagagctaggccagccagaatttgagcaacaacgggaattgcccccctggggagaaatattttctgaatattgtttattcatccgtcccagcaatgtcactgaagaagaaagatttgtacaaagggtagtggactttttgcaaattcattgtcaccaatccatcgttgccgaacccttgtctgaagctcaaactttggagcaccgtcaggggcaaattcattactgccaacaacaacagaaaaatgataaaacccgtcgggtactggaaaaagcttttggggaagcttgggcggaacggtatatgagccaagtcttatttgatgttatccaataataactctgatagtgctagtgtagatctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z