BBa_K1935000 1 BBa_K1935000 nlp22 - neuropeptide-like protein essential for developmental timed sleep 2016-10-07T11:00:00Z 2016-10-08T10:08:53Z nlp22 is a gene in Caenorhabditis elegans. http://www.wormbase.org/species/c_elegans/gene/WBGene00003760#0-9g-3 nlp-22 is involved in embryo development and positive regulation of error-prone translesion synthesis; nlp-22 is expressed in certain interneurons, head, and the ventral nerve cord. This Neuropeptide-Like Protein is a regulator of Caenorhabditis elegans sleep-like quiescence observed during lethargus. nlp-22 shows cyclical mRNA expression in synchrony with lethargus; it is regulated by LIN-42, an orthologue of the core circadian protein PERIOD; and it is expressed in the two RIA interneurons. nlp-22 and the RIA interneurons are required for normal lethargus quiescence, and forced expression of nlp-22 during active stages causes anachronistic locomotion and feeding quiescence. false false _2402_ 25368 25368 9 false in progress false Emilie Gounin annotation2497622 1 stop range2497622 1 310 315 BBa_K1935000_sequence 1 atgcgttccataatcgtcttcatcggattgacgatcttcgcgttggacattcttctggtccagacctcagctcttgggcttcagggtggaatcgatgtcttccgcggattaggagttgtcgatcaagtcgatttcaatcagatccttcaccgagcaaactacctgcgcaacactcgtgaggggcgcttgcgctattggagactccgaacccttccaatcatgaaaaagtcgattgcgattgggcgagccggattccgtccagggaaacgaacaacggacgaactaactggattcccaatcggagtatgataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z