BBa_K1935001 1 BBa_K1935001 DSIP - delta sleep inducing peptide 2016-10-07T11:00:00Z 2016-10-13T07:46:54Z Delta sleep-inducing peptide (DSIP): a still unresolved riddle". Journal of Neurochemistry Kovalzon VM and Strekalova TV (2006) Delta-Sleep-Inducing Peptide (DSIP): A Review MARKUS V. GRAF AND ABBA J.KASTIN DSIP stands for Delta sleep-inducing peptide. This type of peptide is classified as a neuropeptide and it works by inducing delta EEG activity and by reducing motor activity. Its aminoacid sequence is Trp-Ala-Gly-Gly-Asp-Ala-Ser-Gly-Glu, but the gene for this peptide isnt mapped. This peptide was discovered during the mid-70s, by a group of Swiss scientists. They isolated the peptide from the brain blood of rabbits which had been induced into sleep. This group of scientists found that the peptide regulated sleep by inducing a type of sleep which is known as slow-wave sleep. false false _2402_ 25369 25368 9 false in progress false Emilie Gounin annotation2497625 1 DSIP range2497625 1 4 57 annotation2497621 1 ATG range2497621 1 1 3 annotation2497627 1 Peptide 2A sequence range2497627 1 58 70 annotation2497670 1 stop range2497670 1 127 132 annotation2497633 1 DSIP range2497633 1 71 126 BBa_K1935001_sequence 1 atgtgggccggagccgatgcgtccggcgagccagtgaaacagacgctgaattttgatctgttgaaactggccggagatgtggagtcgaatcctggcccgtgggccggtgccgatgcttcaggtgagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z