BBa_K1935001 1 BBa_K1935001 DSIP - delta sleep inducing peptide 2016-10-07T11:00:00Z 2016-10-13T07:46:54Z Delta sleep-inducing peptide (DSIP): a still unresolved riddle". Journal of Neurochemistry Kovalzon VM and Strekalova TV (2006) Delta-Sleep-Inducing Peptide (DSIP): A Review MARKUS V. GRAF AND ABBA J.KASTIN DSIP stands for Delta sleep-inducing peptide. This type of peptide is classified as a neuropeptide and it works by inducing delta EEG activity and by reducing motor activity. Its aminoacid sequence is Trp-Ala-Gly-Gly-Asp-Ala-Ser-Gly-Glu, but the gene for this peptide isnt mapped. This peptide was discovered during the mid-70s, by a group of Swiss scientists. They isolated the peptide from the brain blood of rabbits which had been induced into sleep. This group of scientists found that the peptide regulated sleep by inducing a type of sleep which is known as slow-wave sleep. false false _2402_ 25369 25368 9 false in progress false Emilie Gounin annotation2497670 1 stop range2497670 1 127 132 annotation2497621 1 ATG range2497621 1 1 3 annotation2497627 1 Peptide 2A sequence range2497627 1 58 70 annotation2497625 1 DSIP range2497625 1 4 57 annotation2497633 1 DSIP range2497633 1 71 126 BBa_K1935011 1 BBa_K1935011 DSIP under control of pU6 2016-10-12T11:00:00Z 2016-10-13T08:04:32Z https://www.addgene.org/47943/ This construction was made to test DSIP effect on Caenorhabditis elegans. See BBa_K1935006 for details on U6 promoter See BBa_K1935001 for details on DSIP gene false false _2402_ 25369 25368 9 false Nothing relevant false Emilie Gounin component2497877 1 BBa_K1935006 component2497883 1 BBa_K1935001 annotation2497877 1 BBa_K1935006 range2497877 1 1 157 annotation2497883 1 BBa_K1935001 range2497883 1 164 295 BBa_K1935006 1 BBa_K1935006 pU6 regulatory sequences of C.elegans 2016-10-12T11:00:00Z 2016-10-13T07:08:08Z Addgene : https://www.addgene.org/47943/ pU6 ARN Polymerase III promoter is commonly used for expression of CRISPR guide RNA or small RNA in C. elegans. false false _2402_ 25369 25369 9 false Nothing Relevant. false Jean DESCARPENTRIE annotation2497431 1 promoter range2497431 1 1 157 BBa_K1935001_sequence 1 atgtgggccggagccgatgcgtccggcgagccagtgaaacagacgctgaattttgatctgttgaaactggccggagatgtggagtcgaatcctggcccgtgggccggtgccgatgcttcaggtgagtaataa BBa_K1935011_sequence 1 gagctcccaacacatagtgtttccaatgttatacccaatcaataatagcaagtcaataaactacctctacactatttctggtaataggcgaaacctctacactgtcagtcactttgtaaggtgtgcctatatatttccataatatttcatacaaatttactagatgtgggccggagccgatgcgtccggcgagccagtgaaacagacgctgaattttgatctgttgaaactggccggagatgtggagtcgaatcctggcccgtgggccggtgccgatgcttcaggtgagtaataa BBa_K1935006_sequence 1 gagctcccaacacatagtgtttccaatgttatacccaatcaataatagcaagtcaataaactacctctacactatttctggtaataggcgaaacctctacactgtcagtcactttgtaaggtgtgcctatatatttccataatatttcatacaaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z