BBa_K1935022 1 BBa_K1935022 SET-16 promoter in Caenorhabditis elegans 2016-10-13T11:00:00Z 2016-10-14T10:26:37Z http://www.wormbase.org/species/c_elegans/gene/WBGene00011729#0-9g-3 Ceanorhabditis elegans is an organism with a free-methylated cytosine genome. We looked for a worm???s promoter able to be regulated as mammalian CpG island. pSET-16 is a promoter of Caenorhabditis elegans classified as a HOT (Highly Occupied Target) regions. HOT regions have a rich G-C content that makes them similar to mammalian CpG islands. Some HOT promoters have been mentioned by Chen and one of them, SET-16 (chromosome 3: 13643462-13643761), controls a non-essential gene. That???s why we chose it as a target to test epiCRISPR whithout killing the worm. false false _2402_ 25368 25368 9 false in progress false Emilie Gounin BBa_K1935022_sequence 1 gacgtcttctgaaattcatttaagtctttaaaaacgcacacacgaaagctcgaaaatacatatttgcaaatcaaattatttatttaatttttttccaactctcagtccgcaatctcgcgtggcattcggtgtattggcacagtgccagagagacgcagtgcggcagagatgcgtagccgccccgttaacatggcaaggggctctacgcagcgcgtagagacgcagacatgtaacgcttggcaagatgccaaacaaatcgatacgcccttttcaacagccgttagaggagaatgggcggca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z