BBa_K1937007 1 BBa_K1937007 AF-A : operon of antifungal peptides 2016-10-13T11:00:00Z 2016-10-17T11:22:43Z This gene comes from drosophila and translates a proline-rich peptide whose expression is immune-inducible. The peptide is active against fungi.The D4E1 gene is synthetic and translates a peptide that complexes with cholesterol, current in non-germinated conidia. This synthetic peptide is more resistant than the natural peptide CecroprineA because proteases from fungi have difficulties to degrade the synthetic one (http://www.nrcresearchpress.com/doi/abs/10.1139/w98-032?journalCode=cjm#.V_pRgJOLT6Y). (Chassis E.coli, carrier plasmid pSB1C3, part destined for use in Bacillus subtilis) Length: 1006 bp Background: AF-A is a part designed to be combined with AF-B to form an operon of 5 antifungal peptides. The interest of using several antifungals is to have a broad spectrum of fungi target, because each antifungal has its own characteristics.The peptides were designed to be expressed and secreted by Bacillus subtilis. This operon was also initially designed to be expressed under the control of the pNagA or pNagP promoter (BBa_K1937003 and BBa_K1937005 respectively). In spite of several cloning strategies, the AF-B construction was not obtained, likely due to the toxicity of one of the peptides for Bacillus subtilis. This BioBrick is a part developed by the Toulouse 2016 iGEM team (http://2016.igem.org/Team:Toulouse_France) false false _2404_ 21497 30403 9 false This part encodes two genes encoding antifungal peptides: a cutted Metchnikowin and the D4E1. We created it with the end of the Metchnikowin gene because we found out that only this part of the gene had the antifungal property(http://www.ebi.ac.uk/interpro/entry/IPR012513). The beginning of the gene translates for a propeptide. This gene comes from drosophila and translates a proline-rich peptide whose expression is immune-inducible. The peptide is active against fungi.The D4E1 gene is synthetic and translates a peptide that complexes with cholesterol, current in non-germinated conidia. This synthetic peptide is more resistant than the natural peptide CecroprineA because proteases from fungi have difficulties to degrade the synthetic one (http://www.nrcresearchpress.com/doi/abs/10.1139/w98-032?journalCode=cjm#.V_pRgJOLT6Y). So that each antifungal can be secreted out of the cell, it was necessary to add a sequence called AmyE that enables the transport of molecules outside of the cell. As AmyE is used twice in this Biobrick, we modified the AmyE sequences to avoid homologous recombination while keeping the same protein sequence. The NheI restriction site was added after the RBS to allow promoter swapping with biobrick BAAXXXX or BAAXXXX. SacII and SalI restriction site were added to built the full 5 peptides operon. false Oumnia KARIM annotation2514491 1 D4E1 range2514491 1 589 648 annotation2514485 1 Pveg range2514485 1 1 237 annotation2514488 1 Cutted Metchnikowin range2514488 1 376 453 annotation2514486 1 RBS Metchnikowin range2514486 1 238 249 annotation2514489 1 RBS D4E1 range2514489 1 454 465 annotation2514487 1 amyE for cutted Metchnikowin range2514487 1 253 375 annotation2514490 1 AmyE for D4E1 range2514490 1 466 588 BBa_K1937007_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagtaaaggtggtgaagctagcatgtttgctaagagattcaaaacatccttactccctttgttcgcgggatttttgctgctgtttcacctcgtactggccggtccggcagcagccagtgcagaaaccgcgaataagtctaatgagcatagacatcaaggcccgatttttgatacaagaccgtcaccgtttaatccgaatcaaccgagaccgggcccgatttataaaggtggtgaaatgttcgctaaaagattcaaaaccagcctgctgcctttatttgccggattcctccttctgttccacttagtgctcgcgggtccggcagcagcaagcgccgaaacggcaaataagtcaaatgagtcaagttacgggcgaaaatcaaagtacggctgcgggcgaagatcaagctatgaccaggcaccgcgggtcgactgttatccggctatattgcaggagcgattatgaaacaagaagttatcctggtactcgactgtggcgcgaccaatgtcagggccatcgcggttaatcggcagggcaaaattgttgcccgcgcctcaacgcctaatgccagcgatatcgcgatggaaaacaacacctggcaccagtggtctttagacgccattttgcaacgctttgctgattgctgtcggcaaatcaatagtgaactgactgaatgccacatccgaggtatcgccgtcaccacctttggtgtggatggcgctctggtagata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z