BBa_K1937009 1 BBa_K1937009 Epsilon/MazF : toxin and antitoxin 2016-10-13T11:00:00Z 2016-10-17T12:24:17Z The gene Epsilon codes for a toxin countered by the anti-toxin Zeta (Zielenkiewicz and Cegłowski, 2005 ; Mutschler et al., 2011). The gene MazF encodes the anti-toxin for the MazE toxin (Bravo et al., 1987, Zhang et al., 2005, Wang et al., 2013). (Chassis E. coli, carrier plasmid pSB1C3) Length: 1047 bp Background: This Epsilon/MazF part is one of the two components of a double toxin-antitoxin system. The part was designed to be carried on a plasmid while its counterpart MazE/Zeta was carried on another. Unfortunately, only Epsilon/MazF part was successfully cloned in E. coli. This BioBrick is a part developed by the Toulouse 2016 iGEM team (http://2016.igem.org/Team:Toulouse_France) false false _2404_ 21497 30403 9 false Epsilon and MazF are under the control of the promoter Pveg (constitutive promotor for B. subtilis) followed by a strong RBS. A theophylline-dependent riboswitch was used to prevent the MazE toxin expression during the cloning steps in presence of theophylline (Topp and Gallivan, 2008). Indeed, with an expressed toxin, it would be impossible to clone the Biobrick in E. coli.SacII and SalI are the restriction sites placed respectively before and after the riboswitch so that this fragment can easily be replaced depending on the control we want to apply to the bacteria. false Oumnia KARIM annotation2509760 1 Toxin mazF range2509760 1 586 924 annotation2509754 1 RBS toxin range2509754 1 570 579 annotation2509720 1 Antitoxin Epsilon range2509720 1 250 522 annotation2509756 1 Terminator range2509756 1 925 1004 annotation2509755 1 Riboswitch range2509755 1 529 579 annotation2509716 1 Pveg range2509716 1 1 237 annotation2509724 1 RBS Antitoxin range2509724 1 238 249 BBa_K1937009_sequence 1 ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagtaaaggtggtgaaatggcagttacgtatgaaaaaacatttgaaatagagatcattaacgaattatcggcaagcgtttataatcgagtattaaactatgttttgaaccatgaattaaataaaaatgactctcaattattggaagtcaatttattaaaccaattaaagcttgcaaaacgtgtaaatctttttgattattctttagaagaattacaagccgttcatgagtattggcggtcaatgaatcgttactcaaaacaagttttgaataaagagaaagtggcttaaccgcggatgcaacctgataccagcatcgtcttgatgcccttggcagcaggcaacaagggtaccatggtaagccgatacgtacccgatatgggcgatctgatttgggttgattttgacccgacaaaaggtagcgagcaagctggacatcgtccagctgttgtcctgagtcctttcatgtacaacaacaaaacaggtatgtgtctgtgtgttccttgtacaacgcaatcaaaaggatatccgttcgaagttgttttatccggtcaggaacgtgatggcgtagcgttagctgatcaggtaaaaagtatcgcctggcgggcaagaggagcaacgaagaaaggaacagttgccccagaggaattacaactcattaaagccaaaattaacgtactgattgggtaataaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z