BBa_K194000 1 BBa_K194000 cln2 PEST destabilization domain for rapid protein turnover 2009-07-12T11:00:00Z 2015-05-08T01:11:16Z Saccharomyces cerevisiae genomic DNA, Genbank Accession M33265 C-terminal domain of Saccharomyces cerevisiae cyclin 2 (CLN2) gene. It has been shown that this region of the protein, which is rich of PEST motifs, leads to a destabilization of the protein. Hence this Tag can be used to increase the turn-over rate of a protein. In the article by Mateus and Avery: "Destabilized green Fluorescent protein for monitoring dynamic changes in yeast gene expression with flow cytometry" they show that addition of these 178 carboxyl-terminal amino acid residues changes the half-life of a GFP from 7h and down to 30 minutes. false false _289_ 0 3946 9 It's complicated true The construct follow the Silverfusion standard false Christian Kaas annotation2011259 1 Cln2 Coding sequence range2011259 1 1 537 BBa_K194000_sequence 1 gcatccaacttgaacatttcgagaaagcttaccatatcaaccccatcatgctctttcgaaaattcaaatagcacatccattccttcgcccgcttcctcatctcaaagccacactccaatgagaaacatgagctcactctctgataacagcgttttcagccggaatatggaacaatcatcaccaatcactccaagtatgtaccaatttggtcagcagcagtcaaacagtatatgtggtagcaccgttagtgtgaatagtctggtgaatacaaataacaaacaaaggatctacgaacaaatcacgggtcctaacagcaataacgcaaccaatgattatattgatttgctaaacctaaatgagtctaacaaggaaaaccaaaatcccgcaacggcgcattacctcaatgggggcccacccaagacaagcttcattaaccatggaatgttcccctcgccaactgggaccataaatagcggtaaatctagcagtgcctcatctttaatttcttttggtatgggcaatacccaagtaatatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z