BBa_K1940000 1 BBa_K1940000 anti-microRNA-34c 2016-10-10T11:00:00Z 2016-10-13T09:32:59Z Homo sapiens (human),Chromosome 11, NC_000011.10 (111513439..111513515) Anti- microRNA-34c can be used as a miR-34c detector. MiR-34c is significantly upregulated in Alzheimer's disease (AD) patients. Several researches have suggested that strategies to manipulate miR-34c could open a suitable novel virus-free therapeutic avenue to treat cognitive diseases. In this part, we designed 4 series antisense strand of miR-34c which are linked by 4 linkers. Anti- microRNA-34c is sensitive to the expression levels of miR-34c. And combined with a reporter, we can diagnose AD accurately and rapidly. false false _2407_ 30070 30070 9 true 4 copies of anti-microRNA-34c can enhance the detection sensitivity. false Yujia Liu annotation2492782 1 linker range2492782 1 43 49 annotation2492763 1 anti-microRNA-34c range2492763 1 20 42 annotation2492784 1 linker range2492784 1 103 109 annotation2492781 1 linker range2492781 1 73 79 annotation2492776 1 anti-microRNA-34c range2492776 1 50 72 annotation2492777 1 anti-microRNA-34c range2492777 1 80 102 annotation2492780 1 anti-microRNA-34c range2492780 1 110 132 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K1940001 1 BBa_K1940001 microRNA-34c detector 1.0 2016-10-10T11:00:00Z 2016-10-14T06:36:27Z composited We designed this part to detect the abundance of microRNA-34c. Anti-microRNA-34c ( BBa_K1940000) was insert after a constitutive promoter (BBa_J23106) which express GFP. As anti- microRNA-34c is sensitive to the expression levels of miR-34c, we would have a direct impact on GFP???s expression. Determining GFP???s fluorescence intensity differences will justify the content amount of microRNA-34c. false false _2407_ 30070 30070 9 true We had tested that anti-microRNA-34c be put in this position was most effective than be put after RBS or GFP. false Yujia Liu component2492862 1 BBa_K1940000 component2492873 1 BBa_B0015 component2492866 1 BBa_E0040 component2492854 1 BBa_J23106 component2492864 1 BBa_B0034 annotation2492866 1 BBa_E0040 range2492866 1 221 940 annotation2492854 1 BBa_J23106 range2492854 1 1 35 annotation2492873 1 BBa_B0015 range2492873 1 949 1077 annotation2492864 1 BBa_B0034 range2492864 1 203 214 annotation2492862 1 BBa_K1940000 range2492862 1 44 194 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_K1940000_sequence 1 aagcttggtctcgctagaggcaatcagctaactacactgcctgggtcccgcaatcagctaactacactgcctgggtcccgcaatcagctaactacactgcctgggtcccgcaatcagctaactacactgccttactagcgagaccggtacc BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K1940001_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagaagcttggtctcgctagaggcaatcagctaactacactgcctgggtcccgcaatcagctaactacactgcctgggtcccgcaatcagctaactacactgcctgggtcccgcaatcagctaactacactgccttactagcgagaccggtacctactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z