BBa_K194003 1 BBa_K194003 USER cassette for insertion of USER fragments 2009-10-13T11:00:00Z 2015-05-08T01:11:16Z synthesized This biobrick contains a PacI/Nt.BbvCI and a AsiSI/Nb.BtsI USER cassette for insertion of PCR fragments using the USER cloning standard (see http://2009.igem.org/Team:DTU_Denmark/project). PCR fragments containing uracil is treated with a uracil DNA glycosylase that removes the uracil exposing a predesigned 8bp overhang allowing for cloning without the need for ligase. false false _289_ 0 3946 9 Not in stock true The design follows the biobrick standard false Christian Kaas annotation2042316 1 PacI range2042316 1 10 17 annotation2042317 1 Nt.BbvCI range2042317 1 20 26 annotation2042315 1 Nt.BbvCI range2042315 1 1 7 BBa_K194003_sequence 1 gctgagggtttaattaagacctcagcgcagtggtgcgatcgcgacactgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z