BBa_K1941002 1 BBa_K1941002 scTef1_2PP7 2016-10-12T11:00:00Z 2016-10-18T04:48:28Z some source! Scaffold RNA that targets TEF1 promoter and recruits two times the protein repressor module PCP-Mxi1 via the two effector protein recruitments sites PP7. PP7 is a well-characterized viral RNA sequence which is recognized by PCP protein. This RNA is composed of the dCas9-binding sgRNA which interacts with Tef1, and two times the PCP-binding RNA hairpin PP7. false false _2408_ 29803 30041 9 false some considerations! false Dimitri Coukos BBa_K1941002_sequence 1 ttgatatttaagttaataaagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtggtgcgggagctaaggagtttatatggaaacccttagccgccaggcgtgctgcgtaaggagtttatatggaaacccttacgcagcagttccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z