BBa_K1941003 1 BBa_K1941003 scCyc1_PP7 2016-10-12T11:00:00Z 2016-10-18T05:17:07Z some source! Scaffold RNA that targets the region c6 of CYC1 promoter and recruits the protein repressor module PCP-Mxi via the effector protein recruitments site PP7. PP7 is a well-characterized viral RNA sequence which is recognized by PCP protein. This RNA is composed of the dCas9-binding sgRNA that interacts with CYC1, and the PCP-binding RNA hairpin, PP7. false false _2408_ 29803 30041 9 false some considerations! false Dimitri Coukos BBa_K1941003_sequence 1 cgactactgatgagtccgtgaggacgaaacgagtaagctcgtcttgcagcataaattactatagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtggtgcaacataaggagtttatatggaaacccttatggctttggccggcatggtcccagcctcctcgctggcgccggctgggcaacatgcttcggcatggcgaatgggac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z