BBa_K1942001 1 BBa_K1942001 This part is a short RNA sequence designed for KRAS gene silencing. It is used for down-regulating K 2016-10-09T11:00:00Z 2016-10-10T08:58:01Z SYSU-Software team developed a software to design the anti-KRAS siRNA sequence according to the algorithm we provide and then we ordered the sequence from a DNA synthesis company. This part is a short hairpin RNA (shRNA) sequence. When this sequence is cut by restriction enzyme and then integrated into pcDNA 6.2 vector, it can play an RNAi function in mammalian cell lines such as A549 cells. When the shRNA vector loading anti-KRAS is transfected into A549 cells, the shRNA hairpin structure will be cleaved into anti-KRAS siRNA by Dicer and then construct the RNA-induced silencing complex (RISC). The siRNA-RISC complex will target at KRAS mRNA under the guide of siRNA sequence and digest it. true false _2409_ 29794 29794 9 false We provided algorithm to SYSU-Software team who has developed a software to design siRNA sequence. We could find the best siRNA binding sequence in target gene (KRAS) using this tool to insure the maximum specificity and efficiency of KRAS knock-down, suppressing the target gene???s expression. false Yingzi Chai BBa_K1942001_sequence 1 caccggaagcaagtagtaattgattcaagagatcaattactacttgcttccttttttgatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z