BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_K608007 1 BBa_K608007 medium Promoter , weak RBS 2011-09-14T11:00:00Z 2015-05-08T01:12:52Z composite Released HQ 2013 medium Promotor , weak RBS false false _780_ 0 9115 9 In stock false composite false Julia M??ller component2128663 1 BBa_J23110 component2128665 1 BBa_B0031 annotation2128663 1 BBa_J23110 range2128663 1 1 35 annotation2128665 1 BBa_B0031 range2128665 1 44 57 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J23110 1 BBa_J23110 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1943001 1 BBa_K1943001 fwYellow, yellow chromoprotein reporter system (medium Promoter , weak RBS) 2016-08-28T11:00:00Z 2016-10-21T08:02:33Z basic parts Team Uppsala 2012 chromoprotein attracts many interests because it's more convenient than fluorescent protein for it can be observed with naked eyes. However, characterized data of these proteins are few. Because a single coding region is on the plasmid, we constructed BBa_K1943001 with chromoprotein fwYellow(BBa_K1033910) this year and did characterization. We've constructed a series of plasmids which are all in the same pattern: a strong/weak promoter, a strong/weak RBS and a chromoprotein. We want to monitor the speed of expression of these plasmids in normal incubation conditions (like 37&#8451; overnight for LB agar plate and 37&#8451; 180rpm for LB broth). The expression speed and strength of the constructed biobricks will be carefully monitored and gave others a relative scale for using chromoprotein as a reporter gene. false false _2410_ 30006 29845 9 false no false Shixin Lu, Shiqiang Tang component2481871 1 BBa_K608007 component2481873 1 BBa_K1033910 component2481880 1 BBa_B0015 annotation2481880 1 BBa_B0015 range2481880 1 786 914 annotation2481871 1 BBa_K608007 range2481871 1 1 57 annotation2481873 1 BBa_K1033910 range2481873 1 64 777 BBa_K1033910 1 fwYellow fwYellow, yellow chromoprotein 2013-09-16T11:00:00Z 2016-01-25T02:41:53Z Synthetic chromoprotein from DNA 2.0. This chromoprotein naturally exhibits strong color when expressed. false false _1340_ 4206 13997 9 In stock false This construct is synthetic. It was synthesized from a template where the consensus sequence for the "color dependancy" in order to obtain a chromoprotein with a unique yellow color. false Sabri Jamal annotation2371218 1 fwYellow range2371218 1 1 711 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K608007_sequence 1 tttacggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaacc BBa_K1943001_sequence 1 tttacggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaacctactagatgacggcactgactgaaggcgcaaaactgttcgagaaagaaatcccatatatcactgagctggaaggtgacgttgaaggtatgaagtttatcatcaagggtgaaggtaccggtgacgcgagcgtcggtaaagtggatgctcagttcatttgtaccacgggcgacgttccggttccgtggagcacgctggtcaccacgctgacgtatggtgctcagtgctttgccaagtatccgcgccacattgcggatttcttcaaaagctgcatgccggaaggttacgtccaagagcgcaccatcacctttgagggtgatggcgtgttcaagacccgtgcggaagtcacctttgaaaatggcagcgtgtacaaccgtgtaaaactgaacggccagggtttcaagaaggacggccacgtgctgggcaaaaatctggagtttaactttacccctcattgtttgtacatttggggtgaccaagcgaatcatggcctgaagagcgcgttcaaaatcatgcatgagatcaccggctccaaagaggatttcattgttgccgatcacacccaaatgaataccccgattggtggtggtccggtgcacgtgccggagtaccaccacattacgtatcatgttaccctgtctaaagacgtcaccgatcaccgtgaccatttgaacattgttgaggtgatcaaggcagttgacctggagacgtaccgttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1033910_sequence 1 atgacggcactgactgaaggcgcaaaactgttcgagaaagaaatcccatatatcactgagctggaaggtgacgttgaaggtatgaagtttatcatcaagggtgaaggtaccggtgacgcgagcgtcggtaaagtggatgctcagttcatttgtaccacgggcgacgttccggttccgtggagcacgctggtcaccacgctgacgtatggtgctcagtgctttgccaagtatccgcgccacattgcggatttcttcaaaagctgcatgccggaaggttacgtccaagagcgcaccatcacctttgagggtgatggcgtgttcaagacccgtgcggaagtcacctttgaaaatggcagcgtgtacaaccgtgtaaaactgaacggccagggtttcaagaaggacggccacgtgctgggcaaaaatctggagtttaactttacccctcattgtttgtacatttggggtgaccaagcgaatcatggcctgaagagcgcgttcaaaatcatgcatgagatcaccggctccaaagaggatttcattgttgccgatcacacccaaatgaataccccgattggtggtggtccggtgcacgtgccggagtaccaccacattacgtatcatgttaccctgtctaaagacgtcaccgatcaccgtgaccatttgaacattgttgaggtgatcaaggcagttgacctggagacgtaccgttaataa BBa_B0031_sequence 1 tcacacaggaaacc BBa_J23110_sequence 1 tttacggctagctcagtcctaggtacaatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z