BBa_K1945012 1 BBa_K1945012 BioBrick Prefix 2016-10-20T11:00:00Z 2016-10-21T04:06:37Z This is part of the MCS used by iGEM. This is the iGEM BioBrick Prefix sequence. false false _2412_ 27623 27623 9 false N/A false Sharon Lian BBa_K1945012_sequence 1 gaattcgcggccgcttctagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z