BBa_K1946001 1 BBa_K1946001 pChnB 2016-10-12T11:00:00Z 2016-10-13T05:03:54Z This part is from the first 537bp of GenBank: AB006902.2 This part is the region starting from 537bp upstream of ChnB to its start codon from Acinetobacter sp. cyclohenol gene cluster. pChnB is activated by ChnR (K1946000) in the presence of cyclohexanone. Iwaki H, Hasegawa Y, Teraoka M, Tokuyama T, Bergeron H, Lau PC. Identification of a transcriptional activator (ChnR) and a 6-oxohexanoate dehydrogenase (ChnE) in the cyclohexanol catabolic pathway in Acinetobacter sp. Strain NCIMB 9871 and localization of the genes that encode them. Appl Environ Microbiol. 1999;65(11):5158-62. Steigedal, Magnus and Svein Valla. "The Acinetobacter Sp. Chnb Promoter Together With Its Cognate Positive Regulator Chnr Is An Attractive New Candidate For Metabolic Engineering Applications In Bacteria". Metabolic Engineering 10.2 (2008): 121-129. Web. false false _2413_ 29843 29843 9 false The exact region where ChnR binds is not known. false Musa Efe Işılak annotation2497224 1 promoter range2497224 1 1 537 BBa_K1946001_sequence 1 ggatccttcacagaacatcacctgggtaacaccggaaggtggtggtggtccaaactatccgaatatgtaagtctaatcacttcaaggaagaggtttcccatttcccttctttctagcagatgaagaagcttgcaactaaaagagattgtttggatcagttacccaaaatcgttgaaaagattttaactcttcgatttttattttttaggtaatcctagccctctcgggggctaggattaaaaattttaagttattccaacacgaatgacaaattgttcaatgcaaaataaaaacatacaatatataaatatattttttaattaaaacataagattacaataaaataagaatttttatttggagtttgttttttttctacaatgatcattatgtacaatttttaggttcaccccatccaagccttgtgattgcattcctgcgattctttattcaatgaataagcaatgctattaatcagcaatgaataaccagcactgcggattttgaataaattcacatgtcgtaatggagattatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z