BBa_K1946002 1 BBa_K1946002 sgRNA targeting LacI 2016-10-12T11:00:00Z 2016-10-14T06:17:48Z This part comes from the paper Liu, Yuchen, Yayue Zeng, Li Liu, Chengle Zhuang, Xing Fu, Weiren Huang, and Zhiming Cai. "Synthesizing AND Gate Genetic Circuits Based on CRISPR-Cas9 for Identification of Bladder Cancer Cells." Nature Communications Nat Comms 5 (2014): 5393. This part has a sgRNA targeting lacI. It also has 5' and 3' ribozyme which cleave the RNA molecule with self catalysis so that any sequence can be added to 5' or 3' to this part without preventing Cas9 binding and its activity. false false _2413_ 29843 29843 9 false . false Musa Efe Işılak annotation2497285 1 5 range2497285 1 1 58 annotation2497327 1 Cas9 recognition site range2497327 1 79 162 annotation2497329 1 3' ribozyme range2497329 1 163 205 annotation2497324 1 LacI targeting region range2497324 1 59 78 BBa_K1946002_sequence 1 gtcgacacgtggcctgatgagtccgtgaggacgaaacggtaggaattcctaccgtcgccacgtttctgcgaaaacggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttaccggagtcgactccggtctgatgagtccgtgaggacgaaaaaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z