BBa_K1946006 1 BBa_K1946006 pu 2016-10-12T11:00:00Z 2016-10-13T06:06:13Z Synthetically synthesized from GeneWiz based on Pseudomonas putida TOL plasmid pu promoter drives transcription of the upper operon of Pseudomonas putida mt-2 TOL plasmid for degradation of toluene and xylenes. pu is activated by the activator protein XylR (BBa_K1946005) in the presence of toluene and xylenes. false false _2413_ 29837 29837 9 false . false Ayşe Naz Ozant??rk annotation2497342 1 pu promoter range2497342 1 1 322 BBa_K1946006_sequence 1 gcccgggaaagcgcgatgaaccttttttatcgctgccttgatcaaatcgacaggtggttatgcgcgattgatgatttgctcaaatacagccagcgtgctgtagattttctctcataccccccctttcttttttacaaagaaaatcaataatttagatgaaataaggggatcggtataagcaatggcatggcggttgctagctatacgagacttaaaataaaaatagtggtgacccttcaatgttgtattttctcaactctgttcagattggttgctttcgccatgtatatcctcaaagcgggccagccgtagccgttacgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z