BBa_K1947000 1 Mms13 Mms13 2016-10-12T11:00:00Z 2016-10-14T02:57:17Z This gene comes from the genome of Magnetospirillum magneticum AMB-1. This part is the coding sequence of Mms13. Mms13 is a particle protein, which was found on the membrane of Magnetosome in Magnetospirillum magneticum AMB-1. Our purpose is to display a protein (in our case it is Spycatcher) on the membrane of Magnetosome by fusing the protein with Mms13. false false _2414_ 33528 34115 9 false This part is used to display a recombinant protein on the membrane of Magnetosome. false zhang xucheng BBa_K1947000_sequence 1 atgccctttcaccttgccccctatctggcgaaatccgttcccggcgtcggcgttctcggcgccctggtcggcggcgccgccgccttggccaagaacgtccgcctcctgaaggaaaagcgcatcaccaataccgaagcggccatcgataccggcaaggaaaccgtcggcgccggcctggccaccgcgctttccgccgtggccgcgaccgccgtcggcggcggcctggttgtatcgctgggcaccgccttggtggccggcgttgccgccaaatatgcctgggatcgcggcgtcgatctggtcgagaaggaactgaaccgcggcaaagctgccaacggcgcttccgacgaggacatcttgcgggacgaactggcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z