BBa_K1947002 1 Intein Intein 2016-10-12T11:00:00Z 2016-10-14T02:59:19Z This sequence comes form the gyrA gene of Mycobacterium xenopi This sequence encodes a short polypeptide which can be specifically recognized and spliced by DL-Dithiothreitol（DTT）. In our case we add this short sequence between the recombinant protein which we want to purify and the linker protein Spytag, in order to separate the recombinant protein form the Magnetosome. false false _2414_ 33528 34115 9 false Our project is to use Magnetosome to purify recombinant protein, and we need to remove the protein from the compound after the protein we are interested combined with Magnetosome. As this short polypeptide can be spliced by DTT, we can meet this need by adding the intein between the recombinant protein and magnetosome. false zhang xucheng BBa_K1947002_sequence 1 atgtgcatcacgggagatgcgctggttgccctacccgagggcgagtcggtacgcatcgccgacatcatcccgtgctcgccgaccggctgttccactccggcgagcatccggtgtacacggtgcgtacggtcggtgccgggtgcgcggcccaacagtgacaacgccatcgacctgaaagtccttgaccggcatggcaaaggtctgcgtgtgacgggcaccgcgaaccacccgttgttgtgtttggtcgacgtcgccggggtgccgaccctgctgtggaagctgatcgacgaaatcaagccgggcgattacgcggtgattcaacgcagcgcattcagcgtcgactgtgcaggttttgcccgcggaaaacccgaatttgcgcccacaacctacacagtcggcgtccctggactggtgcgtttcttggaagcacaccaccgagacccggacgcccaagctatcgccgacgagctgaccgacgggcggttctactacgcgaaagtcgccagtgtcaccgacgccggcgtgcagccggtgtatagccttcgtgtcgacacggcagaccacgcgtttatcaccaacgggttcgtcagccacgcgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z