BBa_K1947003 1 SPA Z doma SPA Z domain 2016-10-12T11:00:00Z 2016-10-14T03:01:27Z This sequence comes form the B domain of Protein A of Staphylococcus aureus. The SPA Z domain is a polypeptide mutated from the B domain of Protein A of Staphylococcus aureus. As the molecular weight of this polypeptide has been well characteristic, we use this part to test the stability of our system with different molecular weight by replace the recombinant protein with SPA Z domain in different copy times. false false _2414_ 33528 34115 9 false As the molecular weight of this polypeptide has been well characteristic, we use this part to test the stability of our system with different molecular weight by replace the recombinant protein with SPA Z domain in different copy times. false zhang xucheng BBa_K1947003_sequence 1 atggctgacaacaaattcaacaaagaacagcagaacgctttctacgaaatcctgcacctgccgaacctgaccgaagaacagcgtaacggtgcgatccagtctctgaaagacgacccgtctcagggcggcggcggcggcggctctgctaacctgctggctgaagctaaaaaactgaacgacgctcaggcacccaagtgctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z