BBa_K1947000 1 Mms13 Mms13 2016-10-12T11:00:00Z 2016-10-14T02:57:17Z This gene comes from the genome of Magnetospirillum magneticum AMB-1. This part is the coding sequence of Mms13. Mms13 is a particle protein, which was found on the membrane of Magnetosome in Magnetospirillum magneticum AMB-1. Our purpose is to display a protein (in our case it is Spycatcher) on the membrane of Magnetosome by fusing the protein with Mms13. false false _2414_ 33528 34115 9 false This part is used to display a recombinant protein on the membrane of Magnetosome. false zhang xucheng BBa_K1947004 1 BBa_K1947004 This part serves as a catch system expressed in AMB-1. 2016-10-12T11:00:00Z 2016-10-14T02:56:39Z Magnetic bacterium Magnetospirillum magneticum AMB-1 that can produce magnet particles, also called Magnetosome, covered by a bilayer phospholipid membrane, in which Mms13 protein is anchored；Streptococcus pyogenes fibro-nectin-binding protein FbaB contains a domain with a spontaneous isopeptide bond between Lys31 and Asp117. This domain can be splitted into two fragments: the small one is named as Spytag, while the big one is Spycatcher. Spyatcher is separated from the second immunoglobulin-like collagen adhesin domain (CnaB2) which is come from the fibronectin binding protein FbaB. Mms13 is a protein that bound to magnetosome directly and tightly on a bilayer phospholipid membrane of the bacterial magnetic particles (BMPs). GS linker is used to construct the fusion protein to prevent the two protein from influencing each other. And there is a highly specific recognition and covalent conjugation between Spytag (a peptide with 13 amino acids) and Spycatcher (a small protein consisting of 138 residues). The Spycatcher-Mms13-linked Magnetosome can specifically and covalently conjugate to the Spytag-tagged protein in the bacterial lysate and they can be simply co-purified by a magnet. true false _2414_ 33797 33797 9 false We add GS linker to prevent two protein???s conformation from influencing each other. false Jie Tang component2497355 1 BBa_K1947000 annotation2497355 1 BBa_K1947000 range2497355 1 1 378 BBa_K1947000_sequence 1 atgccctttcaccttgccccctatctggcgaaatccgttcccggcgtcggcgttctcggcgccctggtcggcggcgccgccgccttggccaagaacgtccgcctcctgaaggaaaagcgcatcaccaataccgaagcggccatcgataccggcaaggaaaccgtcggcgccggcctggccaccgcgctttccgccgtggccgcgaccgccgtcggcggcggcctggttgtatcgctgggcaccgccttggtggccggcgttgccgccaaatatgcctgggatcgcggcgtcgatctggtcgagaaggaactgaaccgcggcaaagctgccaacggcgcttccgacgaggacatcttgcgggacgaactggcctaataa BBa_K1947004_sequence 1 atgccctttcaccttgccccctatctggcgaaatccgttcccggcgtcggcgttctcggcgccctggtcggcggcgccgccgccttggccaagaacgtccgcctcctgaaggaaaagcgcatcaccaataccgaagcggccatcgataccggcaaggaaaccgtcggcgccggcctggccaccgcgctttccgccgtggccgcgaccgccgtcggcggcggcctggttgtatcgctgggcaccgccttggtggccggcgttgccgccaaatatgcctgggatcgcggcgtcgatctggtcgagaaggaactgaaccgcggcaaagctgccaacggcgcttccgacgaggacatcttgcgggacgaactggcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z